RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0421279302:

Variant ID: vg0421279302 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21279302
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCACAATGTAAGTCATTCTAGCATTTCGCACATTCATATTGATGTTAATGAATTTAGACATATATATTTATCTAGATTCATTAACATCGAGATAAATGTG[G/A]
AAAATATTAGAATGACTTACATTGTGAAACGGAGGAAGTAGTTAACTTCTGGCTACTTTTTAGACAAGCATTTGTCCAGATGCATAGTCAGAACAGAAGT

Reverse complement sequence

ACTTCTGTTCTGACTATGCATCTGGACAAATGCTTGTCTAAAAAGTAGCCAGAAGTTAACTACTTCCTCCGTTTCACAATGTAAGTCATTCTAATATTTT[C/T]
CACATTTATCTCGATGTTAATGAATCTAGATAAATATATATGTCTAAATTCATTAACATCAATATGAATGTGCGAAATGCTAGAATGACTTACATTGTGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.10%	20.70%	2.18%	0.00%	NA
All Indica	2759	89.60%	9.00%	1.38%	0.00%	NA
All Japonica	1512	58.30%	38.00%	3.77%	0.00%	NA
Aus	269	62.80%	36.40%	0.74%	0.00%	NA
Indica I	595	98.50%	0.00%	1.51%	0.00%	NA
Indica II	465	94.40%	5.20%	0.43%	0.00%	NA
Indica III	913	86.20%	13.40%	0.44%	0.00%	NA
Indica Intermediate	786	84.10%	13.00%	2.93%	0.00%	NA
Temperate Japonica	767	88.50%	7.00%	4.43%	0.00%	NA
Tropical Japonica	504	21.20%	76.80%	1.98%	0.00%	NA
Japonica Intermediate	241	39.40%	55.20%	5.39%	0.00%	NA
VI/Aromatic	96	65.60%	32.30%	2.08%	0.00%	NA
Intermediate	90	63.30%	32.20%	4.44%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421279302	G -> A	LOC_Os04g35020.1	downstream_gene_variant ; 2410.0bp to feature; MODIFIER	silent_mutation	Average:44.626; most accessible tissue: Callus, score: 85.473	N	N	N	N
vg0421279302	G -> A	LOC_Os04g35010.1	intron_variant ; MODIFIER	silent_mutation	Average:44.626; most accessible tissue: Callus, score: 85.473	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421279302	NA	4.29E-06	mr1124	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421279302	NA	9.66E-06	mr1177	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421279302	NA	1.48E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421279302	NA	2.95E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0421279302:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact