Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421072597:

Variant ID: vg0421072597 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21072597
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, C: 0.07, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGCGATCGATCGCCTGGGATGGGGGTAGCGATCAATTCCCCTCCCCCTCCCTCCCTCCACTGGTTTCCTTTTTTGGCACCGCATTACTTTCTTATTTT[C/A]
GTAAATTTATGCACCTAAAGTTTATACACCTCAAGTTTACACATATAAAGTTTAAAGACCCAAAGTTTACACATATAAAGTTTAGAGACCCAAAGTTTAC

Reverse complement sequence

GTAAACTTTGGGTCTCTAAACTTTATATGTGTAAACTTTGGGTCTTTAAACTTTATATGTGTAAACTTGAGGTGTATAAACTTTAGGTGCATAAATTTAC[G/T]
AAAATAAGAAAGTAATGCGGTGCCAAAAAAGGAAACCAGTGGAGGGAGGGAGGGGGAGGGGAATTGATCGCTACCCCCATCCCAGGCGATCGATCGCCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	21.40%	2.12%	23.23%	NA
All Indica	2759	30.20%	27.90%	2.61%	39.33%	NA
All Japonica	1512	98.30%	1.50%	0.13%	0.13%	NA
Aus	269	28.30%	62.50%	8.92%	0.37%	NA
Indica I	595	40.20%	7.60%	0.67%	51.60%	NA
Indica II	465	12.30%	20.20%	2.58%	64.95%	NA
Indica III	913	38.10%	39.50%	2.30%	20.04%	NA
Indica Intermediate	786	24.00%	34.20%	4.45%	37.28%	NA
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	95.40%	4.20%	0.20%	0.20%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	54.20%	44.80%	1.04%	0.00%	NA
Intermediate	90	76.70%	11.10%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421072597	C -> DEL	N	N	silent_mutation	Average:14.391; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0421072597	C -> A	LOC_Os04g34780.1	downstream_gene_variant ; 4509.0bp to feature; MODIFIER	silent_mutation	Average:14.391; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0421072597	C -> A	LOC_Os04g34760-LOC_Os04g34780	intergenic_region ; MODIFIER	silent_mutation	Average:14.391; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421072597	9.44E-07	NA	mr1202	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597	2.07E-06	9.37E-07	mr1202	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597	NA	1.75E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597	6.31E-06	NA	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597	NA	9.46E-06	mr1407	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597	NA	8.98E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597	NA	7.97E-06	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597	NA	8.95E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597	9.02E-07	9.02E-07	mr1770	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251