Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421028122:

Variant ID: vg0421028122 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21028122
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTAAACATTCGCTAATGACAGATTAATTAGGCTTAATAAATTCGTCTCGCGGATTCTGTAATTTGTTTTGTTATTAGACTACGTTTAATACTTCAAAT[G/A]
TGTGTCCGTATATTCGATGTGACATGCTAAAACTTTACATTCCTGGATCTAAACTCAGCCTAAAGTACATATTCTTTCGATACTAGAGTGATCGATCTGA

Reverse complement sequence

TCAGATCGATCACTCTAGTATCGAAAGAATATGTACTTTAGGCTGAGTTTAGATCCAGGAATGTAAAGTTTTAGCATGTCACATCGAATATACGGACACA[C/T]
ATTTGAAGTATTAAACGTAGTCTAATAACAAAACAAATTACAGAATCCGCGAGACGAATTTATTAAGCCTAATTAATCTGTCATTAGCGAATGTTTACTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 41.60% 0.15% 1.02% NA
All Indica  2759 31.00% 68.70% 0.11% 0.14% NA
All Japonica  1512 98.50% 0.30% 0.07% 1.19% NA
Aus  269 82.90% 17.10% 0.00% 0.00% NA
Indica I  595 28.60% 71.30% 0.17% 0.00% NA
Indica II  465 13.30% 86.70% 0.00% 0.00% NA
Indica III  913 44.40% 55.50% 0.00% 0.11% NA
Indica Intermediate  786 27.90% 71.50% 0.25% 0.38% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 0.40% 0.20% 3.37% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 69.80% 1.00% 3.12% 26.04% NA
Intermediate  90 78.90% 20.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421028122 G -> DEL N N silent_mutation Average:47.219; most accessible tissue: Zhenshan97 flower, score: 66.436 N N N N
vg0421028122 G -> A LOC_Os04g34700-LOC_Os04g34690 intergenic_region ; MODIFIER silent_mutation Average:47.219; most accessible tissue: Zhenshan97 flower, score: 66.436 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421028122 NA 7.90E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 5.69E-13 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 1.30E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 9.89E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 1.98E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 2.33E-06 2.32E-06 mr1267_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 1.78E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 6.18E-06 6.18E-06 mr1311_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 6.46E-08 1.22E-09 mr1329_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 2.56E-07 2.56E-07 mr1329_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 1.23E-06 5.08E-07 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 4.59E-06 4.59E-06 mr1337_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 8.89E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 6.45E-06 6.45E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 9.80E-06 5.63E-07 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 2.28E-07 2.14E-09 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 2.43E-07 2.43E-07 mr1524_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 9.96E-06 2.46E-07 mr1549_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 9.77E-24 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 1.62E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 5.92E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 1.79E-06 1.79E-06 mr1674_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 1.43E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 2.32E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 3.64E-07 3.64E-07 mr1688_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 3.59E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 1.86E-06 1.86E-06 mr1697_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 9.59E-16 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 1.37E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 3.52E-07 3.99E-08 mr1757_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 NA 4.17E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 5.09E-06 5.08E-06 mr1843_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 7.23E-06 7.23E-06 mr1847_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 8.75E-06 NA mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 8.84E-06 NA mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 6.96E-06 6.96E-06 mr1981_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 1.38E-06 4.78E-08 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421028122 1.27E-06 1.27E-06 mr1982_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251