Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421019575:

Variant ID: vg0421019575 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21019575
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATAGATACTTTTTTTTTAAAAAAATGCACCGTTTAACAACCTAAAAAAAATGTGCACGTGGAACGCGAGGGAGATGGGTTGAGAACCATGCTACCGAAC[T/A]
AAGCCTGCCTTTTAGGAATTAGGCTTTGTTATCGGGTGGCGTTAGTTCACCCTTTTTCTTTTATCAAATAAAGTGACTCGTGTTTATTGGAGGAGCTAGC

Reverse complement sequence

GCTAGCTCCTCCAATAAACACGAGTCACTTTATTTGATAAAAGAAAAAGGGTGAACTAACGCCACCCGATAACAAAGCCTAATTCCTAAAAGGCAGGCTT[A/T]
GTTCGGTAGCATGGTTCTCAACCCATCTCCCTCGCGTTCCACGTGCACATTTTTTTTAGGTTGTTAAACGGTGCATTTTTTTAAAAAAAAAGTATCTATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.40%	6.50%	0.21%	0.85%	NA
All Indica	2759	95.60%	4.20%	0.04%	0.11%	NA
All Japonica	1512	98.60%	0.20%	0.40%	0.79%	NA
Aus	269	33.80%	66.20%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	93.00%	6.90%	0.11%	0.00%	NA
Indica Intermediate	786	93.60%	6.00%	0.00%	0.38%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.00%	0.60%	1.19%	2.18%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	65.60%	6.20%	2.08%	26.04%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421019575	T -> DEL	N	N	silent_mutation	Average:44.111; most accessible tissue: Callus, score: 88.008	N	N	N	N
vg0421019575	T -> A	LOC_Os04g34700.1	upstream_gene_variant ; 981.0bp to feature; MODIFIER	silent_mutation	Average:44.111; most accessible tissue: Callus, score: 88.008	N	N	N	N
vg0421019575	T -> A	LOC_Os04g34710.1	downstream_gene_variant ; 2878.0bp to feature; MODIFIER	silent_mutation	Average:44.111; most accessible tissue: Callus, score: 88.008	N	N	N	N
vg0421019575	T -> A	LOC_Os04g34710-LOC_Os04g34700	intergenic_region ; MODIFIER	silent_mutation	Average:44.111; most accessible tissue: Callus, score: 88.008	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421019575	NA	3.27E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019575	NA	1.25E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019575	NA	8.08E-07	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019575	NA	3.82E-07	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019575	NA	8.19E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019575	NA	1.21E-06	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019575	NA	8.33E-06	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019575	NA	3.13E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019575	1.61E-06	NA	mr1864	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251