Variant ID: vg0420998565 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 20998565 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )
ATTAATTTATACAAGTATTTGTAAAATCAAGGAGTTGATTTAGATTTTATGATGAAAATATTGGTGGTTTGCTAATGTTAATTTGGAGATTTTATAGATG[G/A]
TTGATTTTGTGAAGTGTACAGTTTCGATTGACCCTGGCGGTCAGACCGGTCGTGTGCCGCCAGTCAGACCGCAGGTGTTGCGGCGGTCAGACCGGTTGGC
GCCAACCGGTCTGACCGCCGCAACACCTGCGGTCTGACTGGCGGCACACGACCGGTCTGACCGCCAGGGTCAATCGAAACTGTACACTTCACAAAATCAA[C/T]
CATCTATAAAATCTCCAAATTAACATTAGCAAACCACCAATATTTTCATCATAAAATCTAAATCAACTCCTTGATTTTACAAATACTTGTATAAATTAAT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.40% | 7.50% | 0.04% | 0.00% | NA |
All Indica | 2759 | 94.80% | 5.10% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Aus | 269 | 27.50% | 72.50% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
Indica III | 913 | 91.10% | 8.70% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0420998565 | G -> A | LOC_Os04g34720.1 | upstream_gene_variant ; 3157.0bp to feature; MODIFIER | silent_mutation | Average:24.984; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
vg0420998565 | G -> A | LOC_Os04g34720.2 | upstream_gene_variant ; 3157.0bp to feature; MODIFIER | silent_mutation | Average:24.984; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
vg0420998565 | G -> A | LOC_Os04g34699.1 | downstream_gene_variant ; 3543.0bp to feature; MODIFIER | silent_mutation | Average:24.984; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
vg0420998565 | G -> A | LOC_Os04g34699-LOC_Os04g34720 | intergenic_region ; MODIFIER | silent_mutation | Average:24.984; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0420998565 | 2.26E-06 | NA | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | 8.30E-08 | NA | mr1123 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | NA | 6.76E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | 1.54E-06 | NA | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | 5.03E-06 | NA | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | 1.82E-06 | NA | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | 1.26E-06 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | 7.33E-06 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | 4.65E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | 1.27E-07 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | 6.82E-08 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | 9.09E-06 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0420998565 | 4.01E-07 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |