Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420700412:

Variant ID: vg0420700412 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20700412
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CATTCCTGTCTAGTTGTCCTCTGAGTTTATCTCAACAAGATGGGGCTCCATGGGGGTAGCGTCCAAAAGATCATTCAGCTCCCTGCTCGGCTGCTCTTCG[G/A]
TGTACAGGCACCTTCACCCCGAGCAAACCCTGCATCTCTGCTCGGCCAACTTTTGTCCCCTCGCCGCTGCATCGACATGTCAGCGTGTGCAACTTGTGTA

Reverse complement sequence

TACACAAGTTGCACACGCTGACATGTCGATGCAGCGGCGAGGGGACAAAAGTTGGCCGAGCAGAGATGCAGGGTTTGCTCGGGGTGAAGGTGCCTGTACA[C/T]
CGAAGAGCAGCCGAGCAGGGAGCTGAATGATCTTTTGGACGCTACCCCCATGGAGCCCCATCTTGTTGAGATAAACTCAGAGGACAACTAGACAGGAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 9.50% 0.08% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 79.80% 20.00% 0.26% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.00% 4.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 88.10% 11.70% 0.13% 0.00% NA
Tropical Japonica  504 69.60% 30.20% 0.20% 0.00% NA
Japonica Intermediate  241 74.30% 24.90% 0.83% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420700412 G -> A LOC_Os04g34160.1 upstream_gene_variant ; 2081.0bp to feature; MODIFIER silent_mutation Average:87.728; most accessible tissue: Minghui63 panicle, score: 98.68 N N N N
vg0420700412 G -> A LOC_Os04g34150.1 downstream_gene_variant ; 1117.0bp to feature; MODIFIER silent_mutation Average:87.728; most accessible tissue: Minghui63 panicle, score: 98.68 N N N N
vg0420700412 G -> A LOC_Os04g34150-LOC_Os04g34160 intergenic_region ; MODIFIER silent_mutation Average:87.728; most accessible tissue: Minghui63 panicle, score: 98.68 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420700412 G A -0.02 -0.01 -0.01 -0.04 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420700412 8.86E-06 NA Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0420700412 8.96E-07 NA mr1416 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420700412 5.50E-06 NA mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420700412 6.63E-07 6.63E-07 mr1883 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251