Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420678772:

Variant ID: vg0420678772 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20678772
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGATTAGGTTGGTTCACAATATGTATAACATGTATGTTGCATTTTTTACCAAATAAAATTTTCAATAATAATCATATATGACATTTATATATCTAGTG[C/T]
ATTGTATTTCTGTAACCCTTATTTTGTTTATAACATGATATTTAGTCAAAATGAGAAAACAATATATCTACTATGTCACCAAATTGTCATCTTGCAAAAA

Reverse complement sequence

TTTTTGCAAGATGACAATTTGGTGACATAGTAGATATATTGTTTTCTCATTTTGACTAAATATCATGTTATAAACAAAATAAGGGTTACAGAAATACAAT[G/A]
CACTAGATATATAAATGTCATATATGATTATTATTGAAAATTTTATTTGGTAAAAAATGCAACATACATGTTATACATATTGTGAACCAACCTAATCCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.00%	1.80%	8.13%	51.04%	NA
All Indica	2759	5.90%	2.60%	5.69%	85.76%	NA
All Japonica	1512	99.50%	0.00%	0.13%	0.33%	NA
Aus	269	8.20%	4.50%	80.67%	6.69%	NA
Indica I	595	6.10%	2.40%	3.19%	88.40%	NA
Indica II	465	8.20%	2.40%	2.15%	87.31%	NA
Indica III	913	3.00%	3.10%	7.45%	86.53%	NA
Indica Intermediate	786	8.00%	2.40%	7.63%	81.93%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	99.20%	0.00%	0.20%	0.60%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	90.60%	1.00%	7.29%	1.04%	NA
Intermediate	90	73.30%	1.10%	1.11%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420678772	C -> DEL	N	N	silent_mutation	Average:22.027; most accessible tissue: Callus, score: 41.842	N	N	N	N
vg0420678772	C -> T	LOC_Os04g34120.1	upstream_gene_variant ; 1251.0bp to feature; MODIFIER	silent_mutation	Average:22.027; most accessible tissue: Callus, score: 41.842	N	N	N	N
vg0420678772	C -> T	LOC_Os04g34110.1	downstream_gene_variant ; 407.0bp to feature; MODIFIER	silent_mutation	Average:22.027; most accessible tissue: Callus, score: 41.842	N	N	N	N
vg0420678772	C -> T	LOC_Os04g34110-LOC_Os04g34120	intergenic_region ; MODIFIER	silent_mutation	Average:22.027; most accessible tissue: Callus, score: 41.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420678772	NA	6.42E-26	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420678772	NA	6.78E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420678772	NA	6.23E-21	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420678772	NA	1.41E-17	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420678772	6.19E-06	1.79E-19	mr1836_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251