Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420368455:

Variant ID: vg0420368455 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20368455
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTAGTATGTAATTTTCGAATTTACATATGTAATTTTAGTACTTACATATGTAATTTTGAGACTTACATTGTAAATACACTAAAATTACATATGTAATTA[G/A]
GGACTTACAATGTAAATACATGTCGACTATTTTTTTTGATGGAAAATATGGCGCCATAAATATAGCATCTCCTCTCTTGCTTCTGATCACCATTATTTTT

Reverse complement sequence

AAAAATAATGGTGATCAGAAGCAAGAGAGGAGATGCTATATTTATGGCGCCATATTTTCCATCAAAAAAAATAGTCGACATGTATTTACATTGTAAGTCC[C/T]
TAATTACATATGTAATTTTAGTGTATTTACAATGTAAGTCTCAAAATTACATATGTAAGTACTAAAATTACATATGTAAATTCGAAAATTACATACTAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	17.10%	0.17%	0.11%	NA
All Indica	2759	99.00%	0.80%	0.07%	0.07%	NA
All Japonica	1512	53.80%	45.80%	0.33%	0.07%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.90%	0.60%	0.22%	0.22%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.00%	0.13%	0.13%	NA
Temperate Japonica	767	79.50%	20.10%	0.39%	0.00%	NA
Tropical Japonica	504	33.70%	66.10%	0.00%	0.20%	NA
Japonica Intermediate	241	14.10%	85.10%	0.83%	0.00%	NA
VI/Aromatic	96	33.30%	66.70%	0.00%	0.00%	NA
Intermediate	90	67.80%	28.90%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420368455	G -> DEL	N	N	silent_mutation	Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467	N	N	N	N
vg0420368455	G -> A	LOC_Os04g33620.1	upstream_gene_variant ; 3701.0bp to feature; MODIFIER	silent_mutation	Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467	N	N	N	N
vg0420368455	G -> A	LOC_Os04g33640.1	upstream_gene_variant ; 4458.0bp to feature; MODIFIER	silent_mutation	Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467	N	N	N	N
vg0420368455	G -> A	LOC_Os04g33640.2	upstream_gene_variant ; 4690.0bp to feature; MODIFIER	silent_mutation	Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467	N	N	N	N
vg0420368455	G -> A	LOC_Os04g33630.1	intron_variant ; MODIFIER	silent_mutation	Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420368455	NA	2.53E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455	NA	2.94E-13	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455	NA	1.72E-10	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455	3.01E-06	NA	mr1404	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455	NA	9.12E-08	mr1404	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455	NA	3.06E-13	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455	NA	1.65E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455	1.82E-06	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455	NA	4.91E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455	NA	7.38E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251