Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419848630:

Variant ID: vg0419848630 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19848630
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, A: 0.33, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TATGTAACTTTTTATTTAAAACATCCTACTTTTATAAATATTATTGATCAAAATAGCATCTCGAATACCATGTCAGAGTTCAAAAATACTTATCTTTTAG[T/A]
ACGGATGGAGTAGTTGACTGAGTCGCGGAAGTTTTTTCACACTTTCATCTAAATAAGACCCAAATAAAATGCGAGTTACACGGCCAACAAACCCCCATTC

Reverse complement sequence

GAATGGGGGTTTGTTGGCCGTGTAACTCGCATTTTATTTGGGTCTTATTTAGATGAAAGTGTGAAAAAACTTCCGCGACTCAGTCAACTACTCCATCCGT[A/T]
CTAAAAGATAAGTATTTTTGAACTCTGACATGGTATTCGAGATGCTATTTTGATCAATAATATTTATAAAAGTAGGATGTTTTAAATAAAAAGTTACATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.00%	40.70%	0.28%	0.00%	NA
All Indica	2759	89.80%	9.90%	0.29%	0.00%	NA
All Japonica	1512	0.70%	99.30%	0.07%	0.00%	NA
Aus	269	94.10%	5.60%	0.37%	0.00%	NA
Indica I	595	84.70%	14.50%	0.84%	0.00%	NA
Indica II	465	87.70%	12.30%	0.00%	0.00%	NA
Indica III	913	96.50%	3.30%	0.22%	0.00%	NA
Indica Intermediate	786	87.20%	12.70%	0.13%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.20%	0.41%	0.00%	NA
VI/Aromatic	96	25.00%	72.90%	2.08%	0.00%	NA
Intermediate	90	27.80%	71.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419848630	T -> A	LOC_Os04g32860.1	upstream_gene_variant ; 4354.0bp to feature; MODIFIER	silent_mutation	Average:52.441; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0419848630	T -> A	LOC_Os04g32870.1	upstream_gene_variant ; 488.0bp to feature; MODIFIER	silent_mutation	Average:52.441; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0419848630	T -> A	LOC_Os04g32880.1	downstream_gene_variant ; 2341.0bp to feature; MODIFIER	silent_mutation	Average:52.441; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0419848630	T -> A	LOC_Os04g32880.2	downstream_gene_variant ; 2746.0bp to feature; MODIFIER	silent_mutation	Average:52.441; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0419848630	T -> A	LOC_Os04g32880.4	downstream_gene_variant ; 2746.0bp to feature; MODIFIER	silent_mutation	Average:52.441; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0419848630	T -> A	LOC_Os04g32880.5	downstream_gene_variant ; 2746.0bp to feature; MODIFIER	silent_mutation	Average:52.441; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0419848630	T -> A	LOC_Os04g32880.3	downstream_gene_variant ; 3692.0bp to feature; MODIFIER	silent_mutation	Average:52.441; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg0419848630	T -> A	LOC_Os04g32860-LOC_Os04g32870	intergenic_region ; MODIFIER	silent_mutation	Average:52.441; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0419848630	T	A	-0.09	-0.05	-0.04	-0.03	-0.05	-0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419848630	NA	2.97E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	2.56E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	1.77E-06	4.18E-07	mr1371_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	3.63E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	1.33E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	3.13E-19	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	5.47E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	5.65E-19	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	6.84E-06	mr1712_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	2.29E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	1.05E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	2.96E-14	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	5.12E-10	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	2.72E-06	mr1946_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	5.12E-10	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	2.72E-06	mr1948_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	NA	4.80E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848630	1.53E-06	2.69E-07	mr1977_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251