Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419441331:

Variant ID: vg0419441331 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19441331
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.14, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCCCTGTCTTACATGTGATTGAAAATAAGTCTATTTCATCTCCTTGAAGTTCGTGCTGTGTCGGGTCGGCCCACCATGTCAAGCCATAGGCCCAGGCA[C/T]
AGCCCAATAGCCGGGCCGTGCTGACACGGGCCCAACAGCGACCGGGCCGTGCTTGGGCCGGGCCAAAATCCTGTGCCGTGGGCTGGGCCATTGTGCCTCA

Reverse complement sequence

TGAGGCACAATGGCCCAGCCCACGGCACAGGATTTTGGCCCGGCCCAAGCACGGCCCGGTCGCTGTTGGGCCCGTGTCAGCACGGCCCGGCTATTGGGCT[G/A]
TGCCTGGGCCTATGGCTTGACATGGTGGGCCGACCCGACACAGCACGAACTTCAAGGAGATGAAATAGACTTATTTTCAATCACATGTAAGACAGGGCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 42.00% 0.08% 0.61% NA
All Indica  2759 92.40% 6.90% 0.07% 0.62% NA
All Japonica  1512 0.30% 99.30% 0.07% 0.33% NA
Aus  269 49.40% 49.40% 0.37% 0.74% NA
Indica I  595 91.40% 8.10% 0.00% 0.50% NA
Indica II  465 88.80% 10.10% 0.22% 0.86% NA
Indica III  913 98.10% 1.60% 0.00% 0.22% NA
Indica Intermediate  786 88.70% 10.20% 0.13% 1.02% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 98.80% 0.20% 0.40% NA
Japonica Intermediate  241 0.00% 98.80% 0.00% 1.24% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 21.10% 73.30% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419441331 C -> DEL LOC_Os04g32420.1 N frameshift_variant Average:94.789; most accessible tissue: Zhenshan97 panicle, score: 98.842 N N N N
vg0419441331 C -> T LOC_Os04g32420.1 missense_variant ; p.Cys31Tyr; MODERATE nonsynonymous_codon ; C31Y Average:94.789; most accessible tissue: Zhenshan97 panicle, score: 98.842 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419441331 C T 0.01 0.01 0.02 0.03 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419441331 NA 2.34E-23 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419441331 NA 3.52E-15 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419441331 NA 1.93E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419441331 NA 3.00E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419441331 NA 6.62E-15 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419441331 NA 1.33E-22 mr1971 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419441331 NA 8.26E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419441331 NA 1.09E-18 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251