Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419261408:

Variant ID: vg0419261408 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19261408
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

ACATGCAAAGATGACACATCATCATCCACTAACAAGATAACGTATCATCATCCACTAATTAACAAGATGCTACATCATCATCCACTAACAATCATCACAT[T/C]
TAAACATCATGCAAGCACGCTATATCTTTATAGTTTTTATAATTTAAGAGCTTTTCAAATACAAACATATTAAATTAAATTATCATCCAACATAATTCAC

Reverse complement sequence

GTGAATTATGTTGGATGATAATTTAATTTAATATGTTTGTATTTGAAAAGCTCTTAAATTATAAAAACTATAAAGATATAGCGTGCTTGCATGATGTTTA[A/G]
ATGTGATGATTGTTAGTGGATGATGATGTAGCATCTTGTTAATTAGTGGATGATGATACGTTATCTTGTTAGTGGATGATGATGTGTCATCTTTGCATGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	9.40%	1.57%	0.00%	NA
All Indica	2759	97.50%	1.50%	1.05%	0.00%	NA
All Japonica	1512	77.80%	19.50%	2.71%	0.00%	NA
Aus	269	72.50%	27.50%	0.00%	0.00%	NA
Indica I	595	92.10%	3.70%	4.20%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.00%	0.38%	0.00%	NA
Temperate Japonica	767	94.80%	3.00%	2.22%	0.00%	NA
Tropical Japonica	504	56.50%	40.30%	3.17%	0.00%	NA
Japonica Intermediate	241	68.00%	28.60%	3.32%	0.00%	NA
VI/Aromatic	96	72.90%	25.00%	2.08%	0.00%	NA
Intermediate	90	84.40%	13.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419261408	T -> C	LOC_Os04g32090-LOC_Os04g32100	intergenic_region ; MODIFIER	silent_mutation	Average:34.098; most accessible tissue: Zhenshan97 root, score: 72.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419261408	NA	2.04E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408	NA	2.14E-08	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408	4.06E-06	2.39E-13	mr1864	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408	NA	5.74E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408	3.00E-06	NA	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408	4.14E-09	NA	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408	NA	1.74E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419261408	NA	5.65E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251