Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418804402:

Variant ID: vg0418804402 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18804402
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AGACCAAAATTATGTCAATCCAAAAATAAAGTGATGTTACCTTGCAACACAATCATCATCTCAAAATTCAAGGGGAGTATGCCGCCAAAATACCTACGAA[C/T]
GAGAAGATGTCGAGGCCTCCGTGTTGGGGTTAGAAATAAGAAATTTTGGAATCCAACACTGAGTCGCACGACCAGTAGAACCAGTAGGTACATACGCACT

Reverse complement sequence

AGTGCGTATGTACCTACTGGTTCTACTGGTCGTGCGACTCAGTGTTGGATTCCAAAATTTCTTATTTCTAACCCCAACACGGAGGCCTCGACATCTTCTC[G/A]
TTCGTAGGTATTTTGGCGGCATACTCCCCTTGAATTTTGAGATGATGATTGTGTTGCAAGGTAACATCACTTTATTTTTGGATTGACATAATTTTGGTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	5.90%	3.32%	20.14%	NA
All Indica	2759	51.10%	9.40%	5.33%	34.18%	NA
All Japonica	1512	99.30%	0.10%	0.53%	0.07%	NA
Aus	269	94.40%	5.60%	0.00%	0.00%	NA
Indica I	595	71.10%	26.20%	0.84%	1.85%	NA
Indica II	465	56.60%	2.20%	5.16%	36.13%	NA
Indica III	913	35.30%	3.80%	7.56%	53.34%	NA
Indica Intermediate	786	51.00%	7.50%	6.23%	35.24%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.40%	0.20%	NA
Japonica Intermediate	241	97.10%	0.40%	2.49%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	0.00%	2.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418804402	C -> DEL	N	N	silent_mutation	Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0418804402	C -> T	LOC_Os04g31430.1	downstream_gene_variant ; 2874.0bp to feature; MODIFIER	silent_mutation	Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0418804402	C -> T	LOC_Os04g31440.1	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0418804402	C -> T	LOC_Os04g31430-LOC_Os04g31440	intergenic_region ; MODIFIER	silent_mutation	Average:15.774; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418804402	7.57E-07	1.22E-08	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402	2.33E-06	3.82E-08	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402	1.57E-09	1.11E-12	mr1389	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402	1.58E-08	1.22E-10	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402	2.85E-07	3.11E-11	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402	1.24E-06	1.02E-09	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402	NA	1.07E-07	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402	NA	5.04E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418804402	NA	5.16E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251