Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418084715:

Variant ID: vg0418084715 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18084715
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:

CACTACTACATAAACAATTTTCCTAAAAGAGGCCCACGTTAGGTTGCAAATGGATCATAATTGACCGCGTCTGCAGAAATCGACCTCCATTTTCGCATAC[G/A]
GACATGTATTGAAAAAAAAATCAATTTTCGTATATGGGCGTCTTAACAGGCCCGCACGCGAAAGTAATATATTTTCGCAGGCAGGCCACTTAAGAGACCC

Reverse complement sequence

GGGTCTCTTAAGTGGCCTGCCTGCGAAAATATATTACTTTCGCGTGCGGGCCTGTTAAGACGCCCATATACGAAAATTGATTTTTTTTTCAATACATGTC[C/T]
GTATGCGAAAATGGAGGTCGATTTCTGCAGACGCGGTCAATTATGATCCATTTGCAACCTAACGTGGGCCTCTTTTAGGAAAATTGTTTATGTAGTAGTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.00%	39.50%	1.59%	14.98%	NA
All Indica	2759	63.00%	21.30%	2.32%	13.45%	NA
All Japonica	1512	12.60%	66.80%	0.26%	20.37%	NA
Aus	269	43.90%	51.70%	0.74%	3.72%	NA
Indica I	595	58.70%	38.80%	2.02%	0.50%	NA
Indica II	465	47.10%	39.10%	3.87%	9.89%	NA
Indica III	913	70.80%	2.10%	0.55%	26.62%	NA
Indica Intermediate	786	66.50%	19.70%	3.69%	10.05%	NA
Temperate Japonica	767	3.00%	97.00%	0.00%	0.00%	NA
Tropical Japonica	504	18.70%	32.50%	0.40%	48.41%	NA
Japonica Intermediate	241	30.30%	42.30%	0.83%	26.56%	NA
VI/Aromatic	96	12.50%	75.00%	1.04%	11.46%	NA
Intermediate	90	23.30%	63.30%	4.44%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418084715	G -> DEL	N	N	silent_mutation	Average:72.651; most accessible tissue: Minghui63 young leaf, score: 94.751	N	N	N	N
vg0418084715	G -> A	LOC_Os04g30280.1	upstream_gene_variant ; 659.0bp to feature; MODIFIER	silent_mutation	Average:72.651; most accessible tissue: Minghui63 young leaf, score: 94.751	N	N	N	N
vg0418084715	G -> A	LOC_Os04g30290.1	upstream_gene_variant ; 1892.0bp to feature; MODIFIER	silent_mutation	Average:72.651; most accessible tissue: Minghui63 young leaf, score: 94.751	N	N	N	N
vg0418084715	G -> A	LOC_Os04g30300.1	downstream_gene_variant ; 3196.0bp to feature; MODIFIER	silent_mutation	Average:72.651; most accessible tissue: Minghui63 young leaf, score: 94.751	N	N	N	N
vg0418084715	G -> A	LOC_Os04g30280-LOC_Os04g30290	intergenic_region ; MODIFIER	silent_mutation	Average:72.651; most accessible tissue: Minghui63 young leaf, score: 94.751	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0418084715	G	A	0.24	0.05	0.02	0.01	0.06	0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418084715	NA	1.30E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	NA	5.43E-06	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	NA	6.49E-09	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	NA	1.56E-06	mr1225	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	7.56E-07	NA	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	2.51E-06	2.51E-06	mr1228	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	NA	7.74E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	7.67E-06	3.30E-08	mr1851	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	NA	2.37E-06	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	NA	4.25E-07	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	NA	2.47E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	NA	4.50E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	NA	2.19E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	NA	5.42E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418084715	NA	3.89E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251