| Variant ID: vg0417803450 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17803450 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 49. )
GTCCGGTAATGCTTTTACATGGTTTACTTCTTTACCGGCAAATTCTATTCATACTTGGGCTCAATTAGAAGAAAAATTTCATGATTATTTCTATACTGGA[A/G]
AAACTGAGCTTAGGTTATGTAATTTGACATCGGTTAAGCAAAAATACAATGAATCTGTCATTGATTATATTAAGAGATTTAGAGATGTTAGAAACCGATG
CATCGGTTTCTAACATCTCTAAATCTCTTAATATAATCAATGACAGATTCATTGTATTTTTGCTTAACCGATGTCAAATTACATAACCTAAGCTCAGTTT[T/C]
TCCAGTATAGAAATAATCATGAAATTTTTCTTCTAATTGAGCCCAAGTATGAATAGAATTTGCCGGTAAAGAAGTAAACCATGTAAAAGCATTACCGGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.40% | 10.60% | 1.23% | 40.80% | NA |
| All Indica | 2759 | 41.60% | 5.00% | 1.56% | 51.90% | NA |
| All Japonica | 1512 | 50.10% | 23.30% | 0.13% | 26.39% | NA |
| Aus | 269 | 69.10% | 0.00% | 4.09% | 26.77% | NA |
| Indica I | 595 | 69.20% | 20.80% | 0.50% | 9.41% | NA |
| Indica II | 465 | 26.70% | 0.40% | 2.15% | 70.75% | NA |
| Indica III | 913 | 27.70% | 0.00% | 1.53% | 70.76% | NA |
| Indica Intermediate | 786 | 45.50% | 1.40% | 2.04% | 51.02% | NA |
| Temperate Japonica | 767 | 15.90% | 39.50% | 0.26% | 44.33% | NA |
| Tropical Japonica | 504 | 91.30% | 0.60% | 0.00% | 8.13% | NA |
| Japonica Intermediate | 241 | 73.00% | 19.50% | 0.00% | 7.47% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 65.60% | 8.90% | 2.22% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417803450 | A -> DEL | N | N | silent_mutation | Average:8.609; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0417803450 | A -> G | LOC_Os04g29860.1 | upstream_gene_variant ; 3729.0bp to feature; MODIFIER | silent_mutation | Average:8.609; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0417803450 | A -> G | LOC_Os04g29870.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.609; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417803450 | 1.72E-06 | 3.66E-06 | mr1744 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417803450 | NA | 6.13E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417803450 | NA | 1.86E-06 | mr1641_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417803450 | NA | 5.29E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417803450 | NA | 9.19E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |