Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417801766:

Variant ID: vg0417801766 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 17801766
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

TAACCTATTCGAATAGCCGCGCCCTCGGTTATGGGCAAGCCTAGCAATGTACCCAAGTTAGTGTTTTAAATTCTTAAAACCTGCTTAATAACTAAAATGT[A/G]
GAATGGTTGGCCTGGGTTGGCTTGGGACGAGCTGGGACCCAGGGTCAGGTTGCCAGTTCGGTCTGAATCATCGTAGGCCTTGGGTTAAGGCAAGTTCGTG

Reverse complement sequence

CACGAACTTGCCTTAACCCAAGGCCTACGATGATTCAGACCGAACTGGCAACCTGACCCTGGGTCCCAGCTCGTCCCAAGCCAACCCAGGCCAACCATTC[T/C]
ACATTTTAGTTATTAAGCAGGTTTTAAGAATTTAAAACACTAACTTGGGTACATTGCTAGGCTTGCCCATAACCGAGGGCGCGGCTATTCGAATAGGTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.20%	23.40%	27.21%	15.21%	NA
All Indica	2759	39.10%	6.30%	42.08%	12.47%	NA
All Japonica	1512	16.90%	57.40%	5.09%	20.57%	NA
Aus	269	69.50%	0.00%	11.52%	18.96%	NA
Indica I	595	68.60%	21.20%	6.55%	3.70%	NA
Indica II	465	18.70%	5.40%	49.68%	26.24%	NA
Indica III	913	27.40%	0.20%	62.43%	9.97%	NA
Indica Intermediate	786	42.50%	2.80%	40.84%	13.87%	NA
Temperate Japonica	767	15.90%	42.10%	6.91%	35.07%	NA
Tropical Japonica	504	21.60%	69.40%	3.37%	5.56%	NA
Japonica Intermediate	241	10.40%	80.90%	2.90%	5.81%	NA
VI/Aromatic	96	62.50%	32.30%	4.17%	1.04%	NA
Intermediate	90	37.80%	34.40%	14.44%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0417801766	A -> DEL	N	N	silent_mutation	Average:15.843; most accessible tissue: Minghui63 flag leaf, score: 29.435	N	N	N	N
vg0417801766	A -> G	LOC_Os04g29860.1	upstream_gene_variant ; 2045.0bp to feature; MODIFIER	silent_mutation	Average:15.843; most accessible tissue: Minghui63 flag leaf, score: 29.435	N	N	N	N
vg0417801766	A -> G	LOC_Os04g29870.1	upstream_gene_variant ; 592.0bp to feature; MODIFIER	silent_mutation	Average:15.843; most accessible tissue: Minghui63 flag leaf, score: 29.435	N	N	N	N
vg0417801766	A -> G	LOC_Os04g29860-LOC_Os04g29870	intergenic_region ; MODIFIER	silent_mutation	Average:15.843; most accessible tissue: Minghui63 flag leaf, score: 29.435	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0417801766	NA	3.92E-06	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417801766	NA	6.49E-06	mr1531_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417801766	NA	6.57E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251