Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417797862:

Variant ID: vg0417797862 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 17797862
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

CTGACCGGCAGGACCGAGTCCGATTTTGTTTCGTCGGGTCTCGAGGTTTCCTTGCTCGGGAAGGCATGTTTCGGGTTTCCTTTAGTTTCTACCCCGAGTT[G/A,C]
GACGTGGAGGAGGGCCTGTAGAGGGCAAGACCAACCCCTATATAAGGGACATGGCCGGTTCATTGTAAAAACTAATCTACTATCAATCAAATCGAATCGT

Reverse complement sequence

ACGATTCGATTTGATTGATAGTAGATTAGTTTTTACAATGAACCGGCCATGTCCCTTATATAGGGGTTGGTCTTGCCCTCTACAGGCCCTCCTCCACGTC[C/T,G]
AACTCGGGGTAGAAACTAAAGGAAACCCGAAACATGCCTTCCCGAGCAAGGAAACCTCGAGACCCGACGAAACAAAATCGGACTCGGTCCTGCCGGTCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.80%	10.60%	7.26%	13.27%	C: 0.04%
All Indica	2759	74.30%	5.00%	10.55%	10.15%	C: 0.07%
All Japonica	1512	51.70%	23.30%	2.71%	22.29%	NA
Aus	269	97.80%	0.70%	1.12%	0.37%	NA
Indica I	595	73.10%	21.00%	2.86%	3.03%	NA
Indica II	465	63.20%	0.20%	19.14%	17.42%	NA
Indica III	913	80.50%	0.00%	7.56%	11.83%	C: 0.11%
Indica Intermediate	786	74.40%	1.40%	14.76%	9.29%	C: 0.13%
Temperate Japonica	767	17.70%	39.20%	3.65%	39.37%	NA
Tropical Japonica	504	92.90%	0.60%	1.79%	4.76%	NA
Japonica Intermediate	241	73.40%	20.30%	1.66%	4.56%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	73.30%	8.90%	8.89%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0417797862	G -> C	LOC_Os04g29870.1	upstream_gene_variant ; 4496.0bp to feature; MODIFIER	silent_mutation	Average:8.01; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0417797862	G -> C	LOC_Os04g29850.1	downstream_gene_variant ; 2100.0bp to feature; MODIFIER	silent_mutation	Average:8.01; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0417797862	G -> C	LOC_Os04g29860.1	downstream_gene_variant ; 1413.0bp to feature; MODIFIER	silent_mutation	Average:8.01; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0417797862	G -> C	LOC_Os04g29850-LOC_Os04g29860	intergenic_region ; MODIFIER	silent_mutation	Average:8.01; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0417797862	G -> DEL	N	N	silent_mutation	Average:8.01; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0417797862	G -> A	LOC_Os04g29870.1	upstream_gene_variant ; 4496.0bp to feature; MODIFIER	silent_mutation	Average:8.01; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0417797862	G -> A	LOC_Os04g29850.1	downstream_gene_variant ; 2100.0bp to feature; MODIFIER	silent_mutation	Average:8.01; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0417797862	G -> A	LOC_Os04g29860.1	downstream_gene_variant ; 1413.0bp to feature; MODIFIER	silent_mutation	Average:8.01; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0417797862	G -> A	LOC_Os04g29850-LOC_Os04g29860	intergenic_region ; MODIFIER	silent_mutation	Average:8.01; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0417797862	2.51E-06	3.33E-08	mr1946	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417797862	NA	7.86E-06	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251