Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417556620:

Variant ID: vg0417556620 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 17556620
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TGAAAACCGCCTCTGCATCCATAACCGTCTAAAGGACCCACATGTCCGTGCCTCTGCCAAAAGTGAGGTCGGTTGGAGCCAACCATTGTTCGGCCAAACC[C/T]
TGGTCAAGCCGGCTCGGGTCCCCCTTACACGTGGACGTCCAGGATGAGCTACTTATGACGGTTACGAGGGTAAAATGGATATTGCGCATCAGAGTAACCG

Reverse complement sequence

CGGTTACTCTGATGCGCAATATCCATTTTACCCTCGTAACCGTCATAAGTAGCTCATCCTGGACGTCCACGTGTAAGGGGGACCCGAGCCGGCTTGACCA[G/A]
GGTTTGGCCGAACAATGGTTGGCTCCAACCGACCTCACTTTTGGCAGAGGCACGGACATGTGGGTCCTTTAGACGGTTATGGATGCAGAGGCGGTTTTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.60%	2.50%	9.92%	15.04%	NA
All Indica	2759	57.50%	4.20%	16.78%	21.53%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	65.40%	0.00%	0.00%	34.57%	NA
Indica I	595	82.20%	9.90%	6.39%	1.51%	NA
Indica II	465	56.80%	1.50%	10.32%	31.40%	NA
Indica III	913	39.80%	2.30%	28.92%	29.03%	NA
Indica Intermediate	786	59.90%	3.60%	14.38%	22.14%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	1.00%	0.00%	18.75%	NA
Intermediate	90	87.80%	0.00%	5.56%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0417556620	C -> DEL	N	N	silent_mutation	Average:30.421; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0417556620	C -> T	LOC_Os04g29550.1	upstream_gene_variant ; 4026.0bp to feature; MODIFIER	silent_mutation	Average:30.421; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0417556620	C -> T	LOC_Os04g29540.1	downstream_gene_variant ; 684.0bp to feature; MODIFIER	silent_mutation	Average:30.421; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0417556620	C -> T	LOC_Os04g29540-LOC_Os04g29550	intergenic_region ; MODIFIER	silent_mutation	Average:30.421; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0417556620	5.86E-09	1.66E-13	mr1038	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417556620	6.29E-11	2.17E-15	mr1389	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417556620	4.74E-15	1.74E-21	mr1038_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417556620	3.25E-09	NA	mr1141_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417556620	9.04E-15	4.26E-20	mr1389_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417556620	NA	9.54E-06	mr1521_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417556620	NA	6.83E-06	mr1576_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417556620	NA	1.45E-08	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251