| Variant ID: vg0416966079 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 16966079 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATATGAGATGTATAATCTGTGATGTATTTGATTTGTTTTGTTTTGTTTAGGATTTGGGATGTATTTGATTTGTGTGTATGAGTAACTTTAAGATTTGTGA[T/C]
GTGGAGTTGAGATGTTATTTGATTTAGGGATTTGGGGATGTGCATGCCACTCGATTCGGGAGAAAATAAAAAAGAAAATAAAAGAAAAGGGGACCATCTG
CAGATGGTCCCCTTTTCTTTTATTTTCTTTTTTATTTTCTCCCGAATCGAGTGGCATGCACATCCCCAAATCCCTAAATCAAATAACATCTCAACTCCAC[A/G]
TCACAAATCTTAAAGTTACTCATACACACAAATCAAATACATCCCAAATCCTAAACAAAACAAAACAAATCAAATACATCACAGATTATACATCTCATAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 1.70% | 2.37% | 2.81% | NA |
| All Indica | 2759 | 95.10% | 1.90% | 2.07% | 0.94% | NA |
| All Japonica | 1512 | 96.60% | 1.70% | 1.65% | 0.07% | NA |
| Aus | 269 | 50.20% | 0.00% | 10.78% | 39.03% | NA |
| Indica I | 595 | 86.60% | 7.40% | 6.05% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 98.10% | 0.00% | 0.88% | 0.99% | NA |
| Indica Intermediate | 786 | 95.70% | 0.90% | 1.27% | 2.16% | NA |
| Temperate Japonica | 767 | 94.70% | 2.50% | 2.87% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.90% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0416966079 | T -> C | LOC_Os04g28640.1 | upstream_gene_variant ; 4556.0bp to feature; MODIFIER | silent_mutation | Average:36.279; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0416966079 | T -> C | LOC_Os04g28650.1 | upstream_gene_variant ; 4226.0bp to feature; MODIFIER | silent_mutation | Average:36.279; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0416966079 | T -> C | LOC_Os04g28640-LOC_Os04g28650 | intergenic_region ; MODIFIER | silent_mutation | Average:36.279; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0416966079 | T -> DEL | N | N | silent_mutation | Average:36.279; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0416966079 | 1.94E-06 | 1.94E-06 | mr1099 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416966079 | NA | 6.47E-06 | mr1222 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416966079 | 7.28E-06 | 7.28E-06 | mr1529 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416966079 | 4.76E-07 | 4.76E-07 | mr1605 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |