| Variant ID: vg0416883574 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 16883574 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 119. )
AAAATGACTTGTAGACTACTATAAAAAAATGTTTTCGTAGATGCCCTCCATTTTGCTGCATAGAGGGTTTTCTAGGCCACAATTCTACATGTGGATGGGT[T/C]
AGGCTATTTAATTTTTTGAGATGATTGTTTTAACATACTCTCTATAAAAGTATAATATTTTCATAGACGGTCGGTCAAAGCCTGTTGATCTAAAAGCACA
TGTGCTTTTAGATCAACAGGCTTTGACCGACCGTCTATGAAAATATTATACTTTTATAGAGAGTATGTTAAAACAATCATCTCAAAAAATTAAATAGCCT[A/G]
ACCCATCCACATGTAGAATTGTGGCCTAGAAAACCCTCTATGCAGCAAAATGGAGGGCATCTACGAAAACATTTTTTTATAGTAGTCTACAAGTCATTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.40% | 12.70% | 1.38% | 2.54% | NA |
| All Indica | 2759 | 89.20% | 6.10% | 1.63% | 3.04% | NA |
| All Japonica | 1512 | 71.20% | 26.80% | 0.99% | 1.06% | NA |
| Aus | 269 | 95.90% | 0.00% | 0.37% | 3.72% | NA |
| Indica I | 595 | 88.60% | 7.40% | 1.34% | 2.69% | NA |
| Indica II | 465 | 68.40% | 14.20% | 6.02% | 11.40% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 90.80% | 6.20% | 1.15% | 1.78% | NA |
| Temperate Japonica | 767 | 92.20% | 7.20% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 39.50% | 56.70% | 1.19% | 2.58% | NA |
| Japonica Intermediate | 241 | 70.50% | 26.60% | 1.66% | 1.24% | NA |
| VI/Aromatic | 96 | 76.00% | 13.50% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 81.10% | 14.40% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0416883574 | T -> C | LOC_Os04g28520.1 | intron_variant ; MODIFIER | silent_mutation | Average:17.619; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0416883574 | T -> C | LOC_Os04g28520.2 | intron_variant ; MODIFIER | silent_mutation | Average:17.619; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0416883574 | T -> DEL | N | N | silent_mutation | Average:17.619; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0416883574 | NA | 1.34E-08 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416883574 | NA | 9.25E-07 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416883574 | NA | 4.64E-08 | mr1124 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416883574 | NA | 6.57E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416883574 | NA | 8.91E-10 | mr1251 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416883574 | NA | 9.90E-06 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416883574 | NA | 1.19E-07 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416883574 | NA | 5.98E-09 | mr1454_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416883574 | NA | 4.18E-07 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416883574 | NA | 1.41E-06 | mr1819_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/