Search for Variation information by Variation ID:
Detailed information for vg0416668164:
| Variant ID: vg0416668164 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 16668164 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 354. )
Flanking Sequence (100 bp) in Reference Genome:
TGAAAGATCATTTGAAGAGAGGTCGAGCGACTCGAGTTGATGTAGCATGCCGAGCTGAGATGGGATCAGTCCAGTGAGGGCATTATGTGACATGTTTACC[C/G]
CACTAAGTAGAACTAGGTCCCCAATAGACTGGGGAATGGCACCATAGAACGCATTATCCGAAACATCAATGACTACAATTGTCCTCAATATCTTCGAAAA
Reverse complement sequence
TTTTCGAAGATATTGAGGACAATTGTAGTCATTGATGTTTCGGATAATGCGTTCTATGGTGCCATTCCCCAGTCTATTGGGGACCTAGTTCTACTTAGTG[G/C]
GGTAAACATGTCACATAATGCCCTCACTGGACTGATCCCATCTCAGCTCGGCATGCTACATCAACTCGAGTCGCTCGACCTCTCTTCAAATGATCTTTCA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 3.10% | 1.44% | 0.00% | NA |
| All Indica | 2759 | 95.00% | 3.90% | 1.16% | 0.00% | NA |
| All Japonica | 1512 | 95.50% | 2.40% | 2.12% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 80.00% | 15.30% | 4.71% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 1.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 91.40% | 4.70% | 3.91% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 2.20% | 3.33% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0416668164 | C -> G | LOC_Os04g28210.1 | missense_variant ; p.Gly890Ala; MODERATE | nonsynonymous_codon ; G890A | Average:61.739; most accessible tissue: Minghui63 flag leaf, score: 79.676 | benign  |
0.636 |
TOLERATED | 0.38 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0416668164 | NA | 1.86E-07 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416668164 | NA | 1.63E-06 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416668164 | NA | 7.11E-07 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416668164 | 1.43E-06 | 1.43E-06 | mr1081_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416668164 | 7.91E-06 | NA | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416668164 | NA | 8.22E-07 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416668164 | 2.37E-06 | 6.21E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416668164 | NA | 9.98E-07 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |