Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416201160:

Variant ID: vg0416201160 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 16201160
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTCGAGCCCAGGTGCAATACACAGTCTGTTACTAAACGAATGAAATGTAAGTAAGCCCGAGTTTAGTTCCAAACTTTTTCTTCAAACTTAGAACTTTTT[C/T]
ATCGCATCAAAATTTTTCTACATATACAAACTTTCAATTTTTCCTATCACATTGTTTCAATTTGGAAAAAGTATACTTTGACTCCCTTAACTATGACCCG

Reverse complement sequence

CGGGTCATAGTTAAGGGAGTCAAAGTATACTTTTTCCAAATTGAAACAATGTGATAGGAAAAATTGAAAGTTTGTATATGTAGAAAAATTTTGATGCGAT[G/A]
AAAAAGTTCTAAGTTTGAAGAAAAAGTTTGGAACTAAACTCGGGCTTACTTACATTTCATTCGTTTAGTAACAGACTGTGTATTGCACCTGGGCTCGACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.70%	11.80%	0.32%	19.17%	NA
All Indica	2759	79.10%	7.80%	0.29%	12.79%	NA
All Japonica	1512	65.10%	0.40%	0.20%	34.33%	NA
Aus	269	1.10%	95.20%	0.37%	3.35%	NA
Indica I	595	99.30%	0.30%	0.00%	0.34%	NA
Indica II	465	78.50%	14.80%	0.22%	6.45%	NA
Indica III	913	64.20%	7.90%	0.22%	27.71%	NA
Indica Intermediate	786	81.60%	9.20%	0.64%	8.65%	NA
Temperate Japonica	767	70.80%	0.00%	0.00%	29.20%	NA
Tropical Japonica	504	49.40%	0.40%	0.40%	49.80%	NA
Japonica Intermediate	241	79.70%	1.70%	0.41%	18.26%	NA
VI/Aromatic	96	14.60%	71.90%	0.00%	13.54%	NA
Intermediate	90	67.80%	15.60%	3.33%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0416201160	C -> DEL	N	N	silent_mutation	Average:87.684; most accessible tissue: Minghui63 root, score: 93.841	N	N	N	N
vg0416201160	C -> T	LOC_Os04g27410.1	intron_variant ; MODIFIER	silent_mutation	Average:87.684; most accessible tissue: Minghui63 root, score: 93.841	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0416201160	C	T	0.01	0.01	0.02	0.02	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0416201160	NA	2.05E-12	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160	NA	2.17E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160	NA	2.38E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160	NA	3.97E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160	NA	4.20E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160	NA	1.56E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160	NA	6.55E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160	NA	9.69E-13	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160	NA	2.67E-06	mr1815_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251