Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415197605:

Variant ID: vg0415197605 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 15197605
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGGTGCAGCGCCTGACGGCGGCGGCTGCCGCAGCGTGAACGCGCAGGCTCTCGGCTCCTGCCTCGGTCCTCGACCTCTCTCCGCTGCCTCCGTCGCCC[C/G]
CGTCTCTCCCTCTGCTCCGTGAAATGGCTGGTTCTTTTATAGCGTGAAGGGGATGCAGTTCTCTGCCCAGTGCATGCATGGCTCACATATGGATGGCAAG

Reverse complement sequence

CTTGCCATCCATATGTGAGCCATGCATGCACTGGGCAGAGAACTGCATCCCCTTCACGCTATAAAAGAACCAGCCATTTCACGGAGCAGAGGGAGAGACG[G/C]
GGGCGACGGAGGCAGCGGAGAGAGGTCGAGGACCGAGGCAGGAGCCGAGAGCCTGCGCGTTCACGCTGCGGCAGCCGCCGCCGTCAGGCGCTGCACCATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	2.10%	9.23%	14.09%	NA
All Indica	2759	79.60%	0.00%	7.65%	12.76%	NA
All Japonica	1512	76.10%	6.50%	5.95%	11.38%	NA
Aus	269	6.70%	0.00%	45.72%	47.58%	NA
Indica I	595	95.50%	0.00%	4.20%	0.34%	NA
Indica II	465	74.80%	0.00%	10.75%	14.41%	NA
Indica III	913	70.10%	0.00%	8.11%	21.80%	NA
Indica Intermediate	786	81.40%	0.00%	7.89%	10.69%	NA
Temperate Japonica	767	57.20%	11.50%	10.17%	21.12%	NA
Tropical Japonica	504	97.40%	1.00%	0.99%	0.60%	NA
Japonica Intermediate	241	91.70%	2.50%	2.90%	2.90%	NA
VI/Aromatic	96	89.60%	0.00%	4.17%	6.25%	NA
Intermediate	90	80.00%	2.20%	8.89%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0415197605	C -> DEL	N	N	silent_mutation	Average:61.693; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg0415197605	C -> G	LOC_Os04g26100.1	downstream_gene_variant ; 492.0bp to feature; MODIFIER	silent_mutation	Average:61.693; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg0415197605	C -> G	LOC_Os04g26100-LOC_Os04g26110	intergenic_region ; MODIFIER	silent_mutation	Average:61.693; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0415197605	C	G	0.0	0.0	0.0	-0.01	0.0	0.0