Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415146457:

Variant ID: vg0415146457 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 15146457
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.29, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

CCCTGACATCTCTGCTGTTGCTAATGGATGATTATGTTTTCGCCGACTTATTATTTCACCTTCACGGTTGACCTACTATGCAAATGCTGATGAGCGTCTT[T/C]
GTCATTATCATTGGTTGCGACACTGCTATTGACTGGATCGCCGACATCGTCATCTTCATCATGTCAGTTGCGTTTGTCGTCGCCGACTATTTTCTTCATC

Reverse complement sequence

GATGAAGAAAATAGTCGGCGACGACAAACGCAACTGACATGATGAAGATGACGATGTCGGCGATCCAGTCAATAGCAGTGTCGCAACCAATGATAATGAC[A/G]
AAGACGCTCATCAGCATTTGCATAGTAGGTCAACCGTGAAGGTGAAATAATAAGTCGGCGAAAACATAATCATCCATTAGCAACAGCAGAGATGTCAGGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.40%	2.30%	0.38%	1.95%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	86.10%	6.90%	0.93%	6.08%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	74.30%	12.30%	1.56%	11.86%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	95.40%	3.70%	0.41%	0.41%	NA
VI/Aromatic	96	95.80%	0.00%	4.17%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0415146457	T -> C	LOC_Os04g26030.1	downstream_gene_variant ; 339.0bp to feature; MODIFIER	silent_mutation	Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969	N	N	N	N
vg0415146457	T -> C	LOC_Os04g26040.1	downstream_gene_variant ; 2195.0bp to feature; MODIFIER	silent_mutation	Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969	N	N	N	N
vg0415146457	T -> C	LOC_Os04g26030-LOC_Os04g26040	intergenic_region ; MODIFIER	silent_mutation	Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969	N	N	N	N
vg0415146457	T -> DEL	N	N	silent_mutation	Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0415146457	NA	9.13E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415146457	1.50E-06	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415146457	NA	5.54E-07	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415146457	1.24E-06	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415146457	NA	1.18E-08	mr1900	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251