Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414588084:

Variant ID: vg0414588084 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14588084
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.11, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCTTTACCCTGTGCAGCCATTGATCTCACTTTCGTGCTTGCTGATGGTCAGGGCGCTCATCCTCCTGCCGGACGCGGTTGCTTCGGCCGAGGTCGCTC[T/G]
CCATGGCCGATGTGCTCCGGCTGTGTACATGTTGTTGCTCCGCCGTCGGTCGGTGTGTATTGTTGGTGCGGCTGGATAGGAATAGATGGATGGATGTGTT

Reverse complement sequence

AACACATCCATCCATCTATTCCTATCCAGCCGCACCAACAATACACACCGACCGACGGCGGAGCAACAACATGTACACAGCCGGAGCACATCGGCCATGG[A/C]
GAGCGACCTCGGCCGAAGCAACCGCGTCCGGCAGGAGGATGAGCGCCCTGACCATCAGCAAGCACGAAAGTGAGATCAATGGCTGCACAGGGTAAAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.40%	5.50%	23.66%	16.53%	NA
All Indica	2759	63.10%	9.00%	20.80%	7.07%	NA
All Japonica	1512	46.20%	0.20%	19.18%	34.46%	NA
Aus	269	4.80%	0.40%	83.27%	11.52%	NA
Indica I	595	57.00%	1.20%	33.61%	8.24%	NA
Indica II	465	27.70%	37.40%	21.51%	13.33%	NA
Indica III	913	82.10%	0.20%	12.71%	4.93%	NA
Indica Intermediate	786	66.70%	8.30%	20.10%	4.96%	NA
Temperate Japonica	767	60.20%	0.00%	19.04%	20.73%	NA
Tropical Japonica	504	22.40%	0.20%	16.87%	60.52%	NA
Japonica Intermediate	241	51.00%	0.80%	24.48%	23.65%	NA
VI/Aromatic	96	62.50%	1.00%	16.67%	19.79%	NA
Intermediate	90	62.20%	5.60%	15.56%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414588084	T -> DEL	LOC_Os04g25230.1	N	frameshift_variant	Average:63.683; most accessible tissue: Minghui63 young leaf, score: 91.282	N	N	N	N
vg0414588084	T -> G	LOC_Os04g25230.1	missense_variant ; p.Glu2Ala; MODERATE	nonsynonymous_codon ; E2A	Average:63.683; most accessible tissue: Minghui63 young leaf, score: 91.282	unknown	unknown	TOLERATED	0.99

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0414588084	T	G	-0.01	-0.03	-0.01	0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414588084	NA	5.40E-10	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	2.50E-07	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	1.86E-07	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	2.19E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	1.26E-06	mr1096	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	1.90E-06	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	1.90E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	3.03E-06	mr1131	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	4.19E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	1.15E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	1.54E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	2.04E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	3.54E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084	NA	7.14E-07	mr1989	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251