Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414583385:

Variant ID: vg0414583385 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14583385
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAGGGATCGATACCAGCATGCAGAATTGCGCGGCAAAAGTGTATGCCCCAGAAAAAAAATTATACTATTTGTTAAGACAATGACAGGCGAAGGTCCATG[T/C]
CGCAAATTCATTCTTCCAACTAGACGGATGGCACATGTTAGTCTGAAGAATTGTGAGGCGAAAACGTGCCTTCGATAAACAATTATATATTTCTTAAAAC

Reverse complement sequence

GTTTTAAGAAATATATAATTGTTTATCGAAGGCACGTTTTCGCCTCACAATTCTTCAGACTAACATGTGCCATCCGTCTAGTTGGAAGAATGAATTTGCG[A/G]
CATGGACCTTCGCCTGTCATTGTCTTAACAAATAGTATAATTTTTTTTCTGGGGCATACACTTTTGCCGCGCAATTCTGCATGCTGGTATCGATCCCTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.50%	25.40%	1.84%	7.28%	NA
All Indica	2759	75.00%	16.20%	2.54%	6.23%	NA
All Japonica	1512	58.90%	30.70%	0.99%	9.46%	NA
Aus	269	3.30%	96.70%	0.00%	0.00%	NA
Indica I	595	65.00%	9.70%	3.53%	21.68%	NA
Indica II	465	66.90%	32.30%	0.65%	0.22%	NA
Indica III	913	82.60%	13.30%	2.41%	1.75%	NA
Indica Intermediate	786	78.60%	15.00%	3.05%	3.31%	NA
Temperate Japonica	767	81.20%	4.30%	0.52%	13.95%	NA
Tropical Japonica	504	22.60%	73.00%	1.39%	2.98%	NA
Japonica Intermediate	241	63.50%	26.10%	1.66%	8.71%	NA
VI/Aromatic	96	64.60%	8.30%	1.04%	26.04%	NA
Intermediate	90	70.00%	24.40%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414583385	T -> C	LOC_Os04g25210.1	upstream_gene_variant ; 4873.0bp to feature; MODIFIER	silent_mutation	Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0414583385	T -> C	LOC_Os04g25220.1	downstream_gene_variant ; 2346.0bp to feature; MODIFIER	silent_mutation	Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0414583385	T -> C	LOC_Os04g25230.1	downstream_gene_variant ; 3265.0bp to feature; MODIFIER	silent_mutation	Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0414583385	T -> C	LOC_Os04g25220-LOC_Os04g25230	intergenic_region ; MODIFIER	silent_mutation	Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0414583385	T -> DEL	N	N	silent_mutation	Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414583385	NA	2.82E-06	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414583385	3.47E-06	3.47E-06	mr1370	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414583385	NA	8.11E-08	mr1637	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414583385	NA	2.67E-07	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414583385	NA	2.67E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414583385	NA	9.50E-07	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251