Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414582739:

Variant ID: vg0414582739 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14582739
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGATAAGGTCTAAAGTAAGTTAGTTAGGCGAACGGCCATGCCATTGTTAACAAACATCCCTCGGACCTGTGTATTAGTGATAAGGTCCAAAGTAAATG[G/A]
ATTAGGCGAACAACCATGCCATTATTAACAAAATACTCCTCAGACCTGTATATTCTAGATGGGGTCCAGAGTAAATACATGAGGCAAAAATCCATGCCAT

Reverse complement sequence

ATGGCATGGATTTTTGCCTCATGTATTTACTCTGGACCCCATCTAGAATATACAGGTCTGAGGAGTATTTTGTTAATAATGGCATGGTTGTTCGCCTAAT[C/T]
CATTTACTTTGGACCTTATCACTAATACACAGGTCCGAGGGATGTTTGTTAACAATGGCATGGCCGTTCGCCTAACTAACTTACTTTAGACCTTATCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	1.40%	6.77%	5.21%	NA
All Indica	2759	83.30%	2.30%	10.08%	4.35%	NA
All Japonica	1512	91.10%	0.20%	1.39%	7.34%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	66.70%	4.00%	15.46%	13.78%	NA
Indica II	465	82.60%	2.40%	14.19%	0.86%	NA
Indica III	913	98.10%	0.50%	0.88%	0.44%	NA
Indica Intermediate	786	79.00%	2.90%	14.25%	3.82%	NA
Temperate Japonica	767	87.40%	0.00%	1.56%	11.08%	NA
Tropical Japonica	504	97.40%	0.00%	0.99%	1.59%	NA
Japonica Intermediate	241	89.60%	1.20%	1.66%	7.47%	NA
VI/Aromatic	96	79.20%	0.00%	10.42%	10.42%	NA
Intermediate	90	81.10%	1.10%	12.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414582739	G -> DEL	N	N	silent_mutation	Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0414582739	G -> A	LOC_Os04g25210.1	upstream_gene_variant ; 4227.0bp to feature; MODIFIER	silent_mutation	Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0414582739	G -> A	LOC_Os04g25220.1	downstream_gene_variant ; 1700.0bp to feature; MODIFIER	silent_mutation	Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0414582739	G -> A	LOC_Os04g25230.1	downstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0414582739	G -> A	LOC_Os04g25220-LOC_Os04g25230	intergenic_region ; MODIFIER	silent_mutation	Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414582739	NA	2.12E-09	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414582739	NA	2.25E-07	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414582739	NA	4.80E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414582739	NA	3.67E-06	mr1726_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414582739	NA	6.82E-06	mr1892_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414582739	NA	2.01E-06	mr1950_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251