Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414209097:

Variant ID: vg0414209097 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14209097
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAGACCCCCGAAGAAATTAGGATGACTCCCACACGGGAGTGGATTCTAATCCCTCAAGGGGATATCCCCTCGTATATCTTTTTTTTTCAAATTCGATG[T/C]
AAATAGTTGTGAAAAATTCTAAAAACAATTGACAATGTAGAGTATAATGATACCTATTAGTCCACCAAAATTCATGTTCAAATTCGATCTACACATCGAG

Reverse complement sequence

CTCGATGTGTAGATCGAATTTGAACATGAATTTTGGTGGACTAATAGGTATCATTATACTCTACATTGTCAATTGTTTTTAGAATTTTTCACAACTATTT[A/G]
CATCGAATTTGAAAAAAAAAGATATACGAGGGGATATCCCCTTGAGGGATTAGAATCCACTCCCGTGTGGGAGTCATCCTAATTTCTTCGGGGGTCTTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.00%	31.20%	1.52%	32.25%	NA
All Indica	2759	11.90%	42.80%	2.03%	43.24%	NA
All Japonica	1512	84.80%	13.80%	0.73%	0.73%	NA
Aus	269	0.40%	4.50%	0.00%	95.17%	NA
Indica I	595	35.50%	33.90%	1.68%	28.91%	NA
Indica II	465	4.30%	27.50%	3.66%	64.52%	NA
Indica III	913	2.50%	60.60%	1.31%	35.60%	NA
Indica Intermediate	786	9.50%	37.90%	2.16%	50.38%	NA
Temperate Japonica	767	96.30%	3.30%	0.00%	0.39%	NA
Tropical Japonica	504	78.80%	19.00%	1.59%	0.60%	NA
Japonica Intermediate	241	60.60%	36.10%	1.24%	2.07%	NA
VI/Aromatic	96	10.40%	47.90%	1.04%	40.62%	NA
Intermediate	90	35.60%	32.20%	4.44%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414209097	T -> C	LOC_Os04g24750.1	upstream_gene_variant ; 476.0bp to feature; MODIFIER	silent_mutation	Average:51.575; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0414209097	T -> C	LOC_Os04g24730-LOC_Os04g24750	intergenic_region ; MODIFIER	silent_mutation	Average:51.575; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0414209097	T -> DEL	N	N	silent_mutation	Average:51.575; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414209097	NA	7.28E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	NA	1.85E-07	mr1066	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	6.55E-06	NA	mr1173	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	5.23E-06	8.03E-10	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	NA	3.52E-06	mr1298	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	NA	3.79E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	9.58E-06	2.79E-07	mr1337	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	NA	9.60E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	2.11E-06	1.28E-07	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	NA	6.73E-06	mr1510	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	4.41E-07	2.54E-10	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	4.61E-06	5.01E-09	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	3.53E-06	3.52E-06	mr1899	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	6.69E-06	6.69E-06	mr1899	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	NA	4.04E-06	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097	1.62E-06	1.62E-06	mr1651_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251