Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413981432:

Variant ID: vg0413981432 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13981432
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGTCTTTTCTGGACTATAGGAAAAAAAAATTAATGGCGAAGGGAAGGGTAAATTCTCTCACCGATGAACCACGCTCTGATACCACCTGATGCGAACACG[C/G]
TAGGGTTTGTGGCCCGATCTTTCGATGAGAGGTAAGGGATAACTCGATTAGATGAAGTCGACGTTCACAGCCCGACTACAACGGTCCAAAGACGCTGCGC

Reverse complement sequence

GCGCAGCGTCTTTGGACCGTTGTAGTCGGGCTGTGAACGTCGACTTCATCTAATCGAGTTATCCCTTACCTCTCATCGAAAGATCGGGCCACAAACCCTA[G/C]
CGTGTTCGCATCAGGTGGTATCAGAGCGTGGTTCATCGGTGAGAGAATTTACCCTTCCCTTCGCCATTAATTTTTTTTTCCTATAGTCCAGAAAAGACCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.30%	9.20%	7.41%	0.02%	NA
All Indica	2759	82.20%	9.40%	8.45%	0.04%	NA
All Japonica	1512	95.10%	0.10%	4.83%	0.00%	NA
Aus	269	22.70%	63.90%	13.38%	0.00%	NA
Indica I	595	97.60%	1.20%	1.01%	0.17%	NA
Indica II	465	67.10%	13.50%	19.35%	0.00%	NA
Indica III	913	78.30%	13.60%	8.11%	0.00%	NA
Indica Intermediate	786	83.80%	8.10%	8.02%	0.00%	NA
Temperate Japonica	767	98.60%	0.00%	1.43%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.40%	0.00%	NA
Japonica Intermediate	241	74.70%	0.40%	24.90%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	87.80%	4.40%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413981432	C -> DEL	N	N	silent_mutation	Average:8.425; most accessible tissue: Callus, score: 26.321	N	N	N	N
vg0413981432	C -> G	LOC_Os04g24370.1	upstream_gene_variant ; 1270.0bp to feature; MODIFIER	silent_mutation	Average:8.425; most accessible tissue: Callus, score: 26.321	N	N	N	N
vg0413981432	C -> G	LOC_Os04g24390.1	upstream_gene_variant ; 2760.0bp to feature; MODIFIER	silent_mutation	Average:8.425; most accessible tissue: Callus, score: 26.321	N	N	N	N
vg0413981432	C -> G	LOC_Os04g24380.1	downstream_gene_variant ; 65.0bp to feature; MODIFIER	silent_mutation	Average:8.425; most accessible tissue: Callus, score: 26.321	N	N	N	N
vg0413981432	C -> G	LOC_Os04g24370-LOC_Os04g24380	intergenic_region ; MODIFIER	silent_mutation	Average:8.425; most accessible tissue: Callus, score: 26.321	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413981432	NA	6.18E-07	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432	NA	1.30E-07	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432	NA	6.14E-07	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432	NA	2.11E-09	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432	NA	4.58E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432	NA	5.30E-06	mr1609	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432	NA	6.79E-07	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432	NA	2.49E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432	NA	7.15E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432	NA	7.95E-07	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432	NA	2.97E-08	mr1892_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432	NA	7.64E-06	mr1892_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251