Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413862399:

Variant ID: vg0413862399 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13862399
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTTGGAGGAATATTATCAGAATGATGAGAAAAATAGGGGAAAAAAAATCCATAAGCCCCTCTACTCTTTCCATACTCTAAATCTTAAGGTGAATGTTC[C/T]
ATCCAACTACAATGACATCTGCTCTTCAGTTACCTTGGCTTCAAGCCTCCATATCGCGGTAAAAGTGAAGAAATAGAGTTAAGGAATTAACAGTATTACA

Reverse complement sequence

TGTAATACTGTTAATTCCTTAACTCTATTTCTTCACTTTTACCGCGATATGGAGGCTTGAAGCCAAGGTAACTGAAGAGCAGATGTCATTGTAGTTGGAT[G/A]
GAACATTCACCTTAAGATTTAGAGTATGGAAAGAGTAGAGGGGCTTATGGATTTTTTTTCCCCTATTTTTCTCATCATTCTGATAATATTCCTCCAAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 7.10% 0.08% 0.00% NA
All Indica  2759 96.10% 3.90% 0.04% 0.00% NA
All Japonica  1512 89.00% 10.90% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.40% 11.40% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.80% 0.00% 0.00% NA
Temperate Japonica  767 97.80% 2.10% 0.13% 0.00% NA
Tropical Japonica  504 86.10% 13.90% 0.00% 0.00% NA
Japonica Intermediate  241 66.80% 32.80% 0.41% 0.00% NA
VI/Aromatic  96 47.90% 51.00% 1.04% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413862399 C -> T LOC_Os04g24220.1 upstream_gene_variant ; 850.0bp to feature; MODIFIER silent_mutation Average:72.875; most accessible tissue: Zhenshan97 flag leaf, score: 92.274 N N N N
vg0413862399 C -> T LOC_Os04g24220.3 upstream_gene_variant ; 823.0bp to feature; MODIFIER silent_mutation Average:72.875; most accessible tissue: Zhenshan97 flag leaf, score: 92.274 N N N N
vg0413862399 C -> T LOC_Os04g24220.2 upstream_gene_variant ; 845.0bp to feature; MODIFIER silent_mutation Average:72.875; most accessible tissue: Zhenshan97 flag leaf, score: 92.274 N N N N
vg0413862399 C -> T LOC_Os04g24210.1 downstream_gene_variant ; 3737.0bp to feature; MODIFIER silent_mutation Average:72.875; most accessible tissue: Zhenshan97 flag leaf, score: 92.274 N N N N
vg0413862399 C -> T LOC_Os04g24210-LOC_Os04g24220 intergenic_region ; MODIFIER silent_mutation Average:72.875; most accessible tissue: Zhenshan97 flag leaf, score: 92.274 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0413862399 C T -0.06 -0.02 -0.01 -0.01 -0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413862399 5.24E-06 NA mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413862399 1.22E-09 NA mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413862399 NA 4.35E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413862399 NA 2.26E-06 mr1698_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413862399 1.07E-12 NA mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413862399 9.17E-11 9.17E-11 mr1730_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413862399 NA 4.25E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413862399 4.88E-11 NA mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413862399 7.27E-09 5.10E-08 mr1866_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413862399 1.13E-06 1.13E-06 mr1912_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251