Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413095791:

Variant ID: vg0413095791 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13095791
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

ATATTGAAACGACAAACCGGTTGATGTTTGGAGTCATCGAATTCGTTGAGATTAATCTCAACGCCTATTTTAGAATTGATTCCATCGCACTCGTCGACGG[A/G]
AAACTCGATGCATCCCCAACCTAGCACGCCAACTGTCGAAACATGAATTCGGCAATAATAAAAAAGGGTAGCGCACTAGACCTAAAATTGGATGGATGCG

Reverse complement sequence

CGCATCCATCCAATTTTAGGTCTAGTGCGCTACCCTTTTTTATTATTGCCGAATTCATGTTTCGACAGTTGGCGTGCTAGGTTGGGGATGCATCGAGTTT[T/C]
CCGTCGACGAGTGCGATGGAATCAATTCTAAAATAGGCGTTGAGATTAATCTCAACGAATTCGATGACTCCAAACATCAACCGGTTTGTCGTTTCAATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	39.40%	1.33%	16.91%	NA
All Indica	2759	68.20%	10.50%	1.49%	19.75%	NA
All Japonica	1512	4.60%	95.00%	0.07%	0.33%	NA
Aus	269	5.90%	5.90%	3.72%	84.39%	NA
Indica I	595	61.50%	25.90%	1.01%	11.60%	NA
Indica II	465	72.00%	11.40%	1.51%	15.05%	NA
Indica III	913	67.80%	2.70%	0.88%	28.59%	NA
Indica Intermediate	786	71.50%	7.50%	2.54%	18.45%	NA
Temperate Japonica	767	2.00%	97.90%	0.13%	0.00%	NA
Tropical Japonica	504	1.20%	98.00%	0.00%	0.79%	NA
Japonica Intermediate	241	19.90%	79.70%	0.00%	0.41%	NA
VI/Aromatic	96	5.20%	75.00%	9.38%	10.42%	NA
Intermediate	90	32.20%	52.20%	2.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413095791	A -> DEL	N	N	silent_mutation	Average:39.608; most accessible tissue: Callus, score: 91.869	N	N	N	N
vg0413095791	A -> G	LOC_Os04g23060.1	upstream_gene_variant ; 442.0bp to feature; MODIFIER	silent_mutation	Average:39.608; most accessible tissue: Callus, score: 91.869	N	N	N	N
vg0413095791	A -> G	LOC_Os04g23050.1	downstream_gene_variant ; 3759.0bp to feature; MODIFIER	silent_mutation	Average:39.608; most accessible tissue: Callus, score: 91.869	N	N	N	N
vg0413095791	A -> G	LOC_Os04g23050-LOC_Os04g23060	intergenic_region ; MODIFIER	silent_mutation	Average:39.608; most accessible tissue: Callus, score: 91.869	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413095791	NA	4.35E-06	mr1064	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791	NA	8.72E-07	mr1245	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791	NA	1.34E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791	NA	6.67E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791	NA	1.15E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791	NA	1.15E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791	NA	4.25E-06	mr1811	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791	NA	5.31E-06	mr1812	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791	NA	1.43E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791	NA	5.02E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791	NA	8.41E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251