Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413012466:

Variant ID: vg0413012466 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13012466
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GACAAAGAAGAAAGTGGTCTTGGATCACGACGATGTAGGTGAGGAGGACACTGCAGAATGGTTCCTAGACACAGGAGCCACCAATCACATGATTGGGGCG[T/C]
GCTCCGCGTTCGCCGACCTCGATGCCGGCGTCGTGGGGACAGTCAAGTTCGGAGATGGCTCTGTGGTAGAAATCCAGGGACGTGGCGCCGTGGTGTTCAA

Reverse complement sequence

TTGAACACCACGGCGCCACGTCCCTGGATTTCTACCACAGAGCCATCTCCGAACTTGACTGTCCCCACGACGCCGGCATCGAGGTCGGCGAACGCGGAGC[A/G]
CGCCCCAATCATGTGATTGGTGGCTCCTGTGTCTAGGAACCATTCTGCAGTGTCCTCCTCACCTACATCGTCGTGATCCAAGACCACTTTCTTCTTTGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	11.00%	0.02%	0.00%	NA
All Indica	2759	92.30%	7.70%	0.04%	0.00%	NA
All Japonica	1512	98.50%	1.50%	0.00%	0.00%	NA
Aus	269	0.70%	99.30%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	85.70%	14.20%	0.11%	0.00%	NA
Indica Intermediate	786	91.50%	8.50%	0.00%	0.00%	NA
Temperate Japonica	767	97.80%	2.20%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413012466	T -> C	LOC_Os04g22920.1	missense_variant ; p.Cys143Arg; MODERATE	nonsynonymous_codon ; C143R	Average:68.088; most accessible tissue: Zhenshan97 young leaf, score: 89.226	probably damaging	-3.26	TOLERATED	0.85

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413012466	NA	3.38E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	NA	2.61E-13	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	3.17E-06	2.03E-46	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	NA	1.78E-45	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	NA	6.45E-13	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	NA	1.37E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	NA	1.39E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	NA	1.14E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	NA	4.34E-07	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	4.02E-07	3.34E-48	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	8.82E-08	1.27E-39	mr1549_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	NA	5.53E-46	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	5.31E-06	1.80E-36	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413012466	NA	1.66E-13	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251