Search for Variation information by Variation ID:
Detailed information for vg0412929168:
| Variant ID: vg0412929168 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12929168 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.32, others allele: 0.00, population size: 53. )
Flanking Sequence (100 bp) in Reference Genome:
GTACCCTAGTCGTTAGGGTGACACCAGGATTTGCAATTCCTGCCGCAGAGGGTCAAGCGTTCAAGCCTACCCCGGAGACCCGAGTGCATGGGGCGCAGCT[A/G]
CTAGCCGGCAATGCCAAAGTTCAGGTGGACTTAGTTAAGCCCGATTGGGTTGGCTACACTATCCCACACCCACCGAATGAGAAGATTCTGACCCTTGGGG
Reverse complement sequence
CCCCAAGGGTCAGAATCTTCTCATTCGGTGGGTGTGGGATAGTGTAGCCAACCCAATCGGGCTTAACTAAGTCCACCTGAACTTTGGCATTGCCGGCTAG[T/C]
AGCTGCGCCCCATGCACTCGGGTCTCCGGGGTAGGCTTGAACGCTTGACCCTCTGCGGCAGGAATTGCAAATCCTGGTGTCACCCTAACGACTAGGGTAC
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.90% | 44.80% | 3.62% | 5.69% | NA |
| All Indica | 2759 | 19.90% | 68.90% | 4.06% | 7.14% | NA |
| All Japonica | 1512 | 95.70% | 0.40% | 1.46% | 2.45% | NA |
| Aus | 269 | 13.40% | 68.80% | 8.92% | 8.92% | NA |
| Indica I | 595 | 38.50% | 50.60% | 5.04% | 5.88% | NA |
| Indica II | 465 | 28.40% | 58.10% | 3.44% | 10.11% | NA |
| Indica III | 913 | 2.40% | 87.80% | 2.08% | 7.67% | NA |
| Indica Intermediate | 786 | 21.20% | 67.00% | 5.98% | 5.73% | NA |
| Temperate Japonica | 767 | 95.30% | 0.50% | 0.78% | 3.39% | NA |
| Tropical Japonica | 504 | 96.80% | 0.00% | 2.58% | 0.60% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.80% | 1.24% | 3.32% | NA |
| VI/Aromatic | 96 | 87.50% | 6.20% | 4.17% | 2.08% | NA |
| Intermediate | 90 | 55.60% | 24.40% | 10.00% | 10.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412929168 | A -> DEL | LOC_Os04g22830.1 | N | frameshift_variant | Average:16.223; most accessible tissue: Callus, score: 26.205 | N | N | N | N |
| vg0412929168 | A -> G | LOC_Os04g22830.1 | synonymous_variant ; p.Leu383Leu; LOW | synonymous_codon | Average:16.223; most accessible tissue: Callus, score: 26.205 | N | N | N | N |
| vg0412929168 | A -> G | LOC_Os04g22830.1 | synonymous_variant ; p.Leu383Leu; LOW | nonsynonymous_codon ; L383Q | Average:16.223; most accessible tissue: Callus, score: 26.205 | benign  |
0.62 |
DELETERIOUS | 0.02 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412929168 | NA | 4.52E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412929168 | NA | 1.18E-25 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412929168 | NA | 2.34E-11 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412929168 | NA | 8.47E-53 | mr1889 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412929168 | NA | 1.06E-24 | mr1903 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412929168 | NA | 6.76E-80 | mr1907 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412929168 | NA | 3.24E-38 | mr1932 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412929168 | 6.05E-06 | NA | mr1033_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412929168 | NA | 9.67E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412929168 | NA | 9.25E-30 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412929168 | NA | 3.80E-17 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |