Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412903510:

Variant ID: vg0412903510 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12903510
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGGAGCTAGAGCTTTGCTTGAAGTATCTTCTTCTGCCTCATCAAGATAATCTTTGATATCAAAAGAGAAGAGATCGGCTAGAACCTGCAGGTATAAGTT[T/C]
AGAAAGTTTGAGAGCTAAGTCAATATAGTCGATCTAAATTCTTGCATCAAAGGAAAACTTACTGGGATAGCAGGAGCAGCCGATTGTTCTTCTTCCACAA

Reverse complement sequence

TTGTGGAAGAAGAACAATCGGCTGCTCCTGCTATCCCAGTAAGTTTTCCTTTGATGCAAGAATTTAGATCGACTATATTGACTTAGCTCTCAAACTTTCT[A/G]
AACTTATACCTGCAGGTTCTAGCCGATCTCTTCTCTTTTGATATCAAAGATTATCTTGATGAGGCAGAAGAAGATACTTCAAGCAAAGCTCTAGCTCCCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.30%	20.60%	15.13%	25.03%	NA
All Indica	2759	36.70%	3.80%	23.12%	36.32%	NA
All Japonica	1512	48.20%	49.50%	1.06%	1.26%	NA
Aus	269	26.80%	2.60%	17.47%	53.16%	NA
Indica I	595	43.70%	4.70%	27.56%	24.03%	NA
Indica II	465	38.10%	6.20%	28.39%	27.31%	NA
Indica III	913	33.50%	1.00%	16.21%	49.29%	NA
Indica Intermediate	786	34.40%	5.10%	24.68%	35.88%	NA
Temperate Japonica	767	84.70%	12.90%	1.43%	0.91%	NA
Tropical Japonica	504	5.60%	92.90%	0.60%	0.99%	NA
Japonica Intermediate	241	21.20%	75.10%	0.83%	2.90%	NA
VI/Aromatic	96	8.30%	85.40%	1.04%	5.21%	NA
Intermediate	90	36.70%	33.30%	14.44%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412903510	T -> C	LOC_Os04g22770.1	upstream_gene_variant ; 4622.0bp to feature; MODIFIER	silent_mutation	Average:8.048; most accessible tissue: Callus, score: 21.998	N	N	N	N
vg0412903510	T -> C	LOC_Os04g22780.1	downstream_gene_variant ; 1307.0bp to feature; MODIFIER	silent_mutation	Average:8.048; most accessible tissue: Callus, score: 21.998	N	N	N	N
vg0412903510	T -> C	LOC_Os04g22790.1	intron_variant ; MODIFIER	silent_mutation	Average:8.048; most accessible tissue: Callus, score: 21.998	N	N	N	N
vg0412903510	T -> DEL	N	N	silent_mutation	Average:8.048; most accessible tissue: Callus, score: 21.998	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412903510	NA	3.83E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510	NA	1.54E-06	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510	NA	3.52E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510	NA	4.90E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510	NA	2.04E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510	NA	2.16E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510	NA	4.10E-09	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510	3.55E-06	NA	mr1719	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510	NA	3.18E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510	NA	4.28E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510	NA	1.30E-07	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251