Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412792403:

Variant ID: vg0412792403 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12792403
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTATATGCAAGGCCGACGTTGTCAAGTACATGCTATCGGCTCAAAAATTAAAAGGAAGGGTTGGAAAGTGGATATTTTCCTTAACCGAGTTTGATCTTC[T/G]
GTATGAGTCGCCGAAGGCGATTAAGGACAAGCAATAGCTGATTTTATTGTGGAACATCGTGATGACTTAGTCGGCTCGGTTGAAATAGTGCCATGGACTT

Reverse complement sequence

AAGTCCATGGCACTATTTCAACCGAGCCGACTAAGTCATCACGATGTTCCACAATAAAATCAGCTATTGCTTGTCCTTAATCGCCTTCGGCGACTCATAC[A/C]
GAAGATCAAACTCGGTTAAGGAAAATATCCACTTTCCAACCCTTCCTTTTAATTTTTGAGCCGATAGCATGTACTTGACAACGTCGGCCTTGCATATAAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	1.90%	0.47%	45.13%	NA
All Indica	2759	29.60%	1.00%	0.72%	68.65%	NA
All Japonica	1512	95.20%	4.00%	0.00%	0.86%	NA
Aus	269	27.50%	0.00%	0.74%	71.75%	NA
Indica I	595	57.60%	0.00%	0.50%	41.85%	NA
Indica II	465	34.60%	4.30%	0.43%	60.65%	NA
Indica III	913	5.70%	0.10%	0.99%	93.21%	NA
Indica Intermediate	786	33.30%	0.80%	0.76%	65.14%	NA
Temperate Japonica	767	97.30%	2.30%	0.00%	0.39%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	79.70%	17.40%	0.00%	2.90%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	65.60%	3.30%	0.00%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412792403	T -> DEL	N	N	silent_mutation	Average:7.691; most accessible tissue: Callus, score: 30.713	N	N	N	N
vg0412792403	T -> G	LOC_Os04g22600.1	upstream_gene_variant ; 3136.0bp to feature; MODIFIER	silent_mutation	Average:7.691; most accessible tissue: Callus, score: 30.713	N	N	N	N
vg0412792403	T -> G	LOC_Os04g22590.1	downstream_gene_variant ; 192.0bp to feature; MODIFIER	silent_mutation	Average:7.691; most accessible tissue: Callus, score: 30.713	N	N	N	N
vg0412792403	T -> G	LOC_Os04g22590-LOC_Os04g22600	intergenic_region ; MODIFIER	silent_mutation	Average:7.691; most accessible tissue: Callus, score: 30.713	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412792403	1.95E-06	1.95E-06	mr1651	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412792403	NA	6.05E-06	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412792403	NA	9.61E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251