Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412757195:

Variant ID: vg0412757195 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12757195
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

TGGACCATAATTGACTTGGTTCATCATTCCACAAATCAATAAAAAATATAGAAGATTAAGAGGCAAAATAAGTAAGATCCTATTAATCTTGTCATTTGAT[G/A]
GCAAAGATGAAGCTTTACTAAGGGGTTGTAGCAACTCTAAATTTAATAATAATAAAGCTCACTTTCCTCGCAAGGGGAAATAAAATTGCCTCTATGTCCT

Reverse complement sequence

AGGACATAGAGGCAATTTTATTTCCCCTTGCGAGGAAAGTGAGCTTTATTATTATTAAATTTAGAGTTGCTACAACCCCTTAGTAAAGCTTCATCTTTGC[C/T]
ATCAAATGACAAGATTAATAGGATCTTACTTATTTTGCCTCTTAATCTTCTATATTTTTTATTGATTTGTGGAATGATGAACCAAGTCAATTATGGTCCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.80%	36.70%	7.81%	4.70%	NA
All Indica	2759	76.00%	4.10%	12.00%	7.90%	NA
All Japonica	1512	1.50%	98.00%	0.46%	0.07%	NA
Aus	269	90.30%	1.10%	8.18%	0.37%	NA
Indica I	595	79.20%	3.90%	11.09%	5.88%	NA
Indica II	465	73.10%	8.80%	9.68%	8.39%	NA
Indica III	913	77.20%	1.90%	16.43%	4.49%	NA
Indica Intermediate	786	73.80%	4.20%	8.91%	13.10%	NA
Temperate Japonica	767	1.00%	98.20%	0.65%	0.13%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	95.90%	0.83%	0.00%	NA
VI/Aromatic	96	9.40%	88.50%	2.08%	0.00%	NA
Intermediate	90	34.40%	55.60%	7.78%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412757195	G -> DEL	N	N	silent_mutation	Average:11.898; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0412757195	G -> A	LOC_Os04g22520.1	upstream_gene_variant ; 3771.0bp to feature; MODIFIER	silent_mutation	Average:11.898; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0412757195	G -> A	LOC_Os04g22510-LOC_Os04g22520	intergenic_region ; MODIFIER	silent_mutation	Average:11.898; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412757195	NA	6.25E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412757195	NA	4.36E-14	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412757195	NA	9.03E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412757195	1.43E-06	NA	mr1935	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412757195	NA	6.19E-08	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251