Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412701691:

Variant ID: vg0412701691 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12701691
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.03, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TAACAGACTCCCTCATGGAGGTGAATAAAAGGAAAGAAAAAAACCCAGAAAAGCTGCAGTCAGTTCGCACCACCAAAAACTCTGTTTTTCGTTTCAGTTC[T/A]
TCAGTTACTGTTCACGTCTGGAAAATATTCGGAGATTGTAGGTTAGCCACTGATCGAGAGCTGAGCTAGGGGTTTTTGCTGACAGTTACTTTATGGCTTG

Reverse complement sequence

CAAGCCATAAAGTAACTGTCAGCAAAAACCCCTAGCTCAGCTCTCGATCAGTGGCTAACCTACAATCTCCGAATATTTTCCAGACGTGAACAGTAACTGA[A/T]
GAACTGAAACGAAAAACAGAGTTTTTGGTGGTGCGAACTGACTGCAGCTTTTCTGGGTTTTTTTCTTTCCTTTTATTCACCTCCATGAGGGAGTCTGTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.00%	35.90%	0.13%	0.02%	NA
All Indica	2759	94.30%	5.50%	0.18%	0.04%	NA
All Japonica	1512	6.50%	93.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	0.80%	0.34%	0.00%	NA
Indica II	465	76.60%	23.20%	0.22%	0.00%	NA
Indica III	913	98.90%	0.90%	0.22%	0.00%	NA
Indica Intermediate	786	96.10%	3.80%	0.00%	0.13%	NA
Temperate Japonica	767	5.20%	94.80%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	21.60%	78.40%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	47.80%	51.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412701691	T -> DEL	N	N	silent_mutation	Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg0412701691	T -> A	LOC_Os04g22420.1	downstream_gene_variant ; 3863.0bp to feature; MODIFIER	silent_mutation	Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg0412701691	T -> A	LOC_Os04g22430.1	downstream_gene_variant ; 356.0bp to feature; MODIFIER	silent_mutation	Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg0412701691	T -> A	LOC_Os04g22430-LOC_Os04g22440	intergenic_region ; MODIFIER	silent_mutation	Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412701691	NA	1.03E-21	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691	1.89E-06	4.07E-07	mr1193	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691	NA	4.66E-16	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691	NA	5.65E-08	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691	3.51E-06	2.56E-07	mr1525	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691	NA	6.66E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691	NA	7.63E-13	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691	NA	3.94E-12	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691	NA	1.24E-26	mr1903	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691	NA	2.94E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691	5.04E-06	NA	mr1865_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251