Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412697867:

Variant ID: vg0412697867 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12697867
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAGAAGCAAGTTGTATCTCACGGAGGAACAATGGCAGGCACGGAGCAAGCAGAAGGAGTAGGATGCATCTGGTGGTGGTGGAAAGGGTCGCAGCAGCTC[T/G]
GGCGCACCGAATCGCCAAGGCAAACCTGCTGGTACACCAAAGGGAAAAGAGGCAGCTTCCGGGGAGAGCGGCGGCCGTGACATCTCAAAGGTGAAGTGCT

Reverse complement sequence

AGCACTTCACCTTTGAGATGTCACGGCCGCCGCTCTCCCCGGAAGCTGCCTCTTTTCCCTTTGGTGTACCAGCAGGTTTGCCTTGGCGATTCGGTGCGCC[A/C]
GAGCTGCTGCGACCCTTTCCACCACCACCAGATGCATCCTACTCCTTCTGCTTGCTCCGTGCCTGCCATTGTTCCTCCGTGAGATACAACTTGCTTCTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.40%	38.90%	6.86%	5.86%	NA
All Indica	2759	69.80%	9.50%	11.09%	9.60%	NA
All Japonica	1512	5.80%	94.10%	0.07%	0.07%	NA
Aus	269	87.00%	5.60%	4.09%	3.35%	NA
Indica I	595	62.90%	12.30%	21.34%	3.53%	NA
Indica II	465	59.60%	15.10%	8.39%	16.99%	NA
Indica III	913	75.80%	5.10%	7.34%	11.72%	NA
Indica Intermediate	786	74.00%	9.30%	9.29%	7.38%	NA
Temperate Japonica	767	4.60%	95.40%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	98.80%	0.20%	0.00%	NA
Japonica Intermediate	241	19.50%	80.10%	0.00%	0.41%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	37.80%	53.30%	6.67%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412697867	T -> DEL	N	N	silent_mutation	Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0412697867	T -> G	LOC_Os04g22410.1	upstream_gene_variant ; 2678.0bp to feature; MODIFIER	silent_mutation	Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0412697867	T -> G	LOC_Os04g22430.1	upstream_gene_variant ; 376.0bp to feature; MODIFIER	silent_mutation	Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0412697867	T -> G	LOC_Os04g22420.1	downstream_gene_variant ; 39.0bp to feature; MODIFIER	silent_mutation	Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0412697867	T -> G	LOC_Os04g22420-LOC_Os04g22430	intergenic_region ; MODIFIER	silent_mutation	Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412697867	NA	1.68E-21	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	4.63E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	7.89E-18	mr1239	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	5.71E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	4.83E-21	mr1254	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	3.18E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	9.12E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	6.02E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	2.48E-11	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	1.51E-24	mr1903	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	1.66E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	3.56E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867	NA	9.93E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251