RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0412231824:

Variant ID: vg0412231824 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12231824
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

TCAGAGATAACGTTAGACTTCCTTTGTCAGCCTCGTGCGGGCACCTAAAGGGTTTGTCTGAGTCAATCTCTGATGTCAACCGAGAAAGTACAGAGCATAC[G/A]
ACTAAGTCTCCCGTCTTGCTGTAATCGAGAATTTGGATTGAAGTCAAGAAATTTTATCTCGGCGGGTACACCATTTCTTCATTCTGTATTCCTTGTCGAG

Reverse complement sequence

CTCGACAAGGAATACAGAATGAAGAAATGGTGTACCCGCCGAGATAAAATTTCTTGACTTCAATCCAAATTCTCGATTACAGCAAGACGGGAGACTTAGT[C/T]
GTATGCTCTGTACTTTCTCGGTTGACATCAGAGATTGACTCAGACAAACCCTTTAGGTGCCCGCACGAGGCTGACAAAGGAAGTCTAACGTTATCTCTGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.40%	0.80%	0.40%	0.36%	NA
All Indica	2759	97.80%	1.30%	0.54%	0.33%	NA
All Japonica	1512	99.50%	0.00%	0.13%	0.40%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	0.30%	0.84%	0.00%	NA
Indica II	465	97.00%	2.60%	0.22%	0.22%	NA
Indica III	913	98.00%	1.00%	0.44%	0.55%	NA
Indica Intermediate	786	97.30%	1.70%	0.64%	0.38%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.20%	0.00%	0.20%	0.60%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	2.20%	2.22%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412231824	G -> A	LOC_Os04g21610.1	upstream_gene_variant ; 2713.0bp to feature; MODIFIER	N	Average:12.065; most accessible tissue: Minghui63 young leaf, score: 16.99	N	N	N	N
vg0412231824	G -> A	LOC_Os04g21620.1	upstream_gene_variant ; 1403.0bp to feature; MODIFIER	N	Average:12.065; most accessible tissue: Minghui63 young leaf, score: 16.99	N	N	N	N
vg0412231824	G -> A	LOC_Os04g21610-LOC_Os04g21620	intergenic_region ; MODIFIER	N	Average:12.065; most accessible tissue: Minghui63 young leaf, score: 16.99	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412231824	3.15E-06	1.04E-21	mr1039	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412231824	NA	9.89E-10	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412231824	9.99E-10	2.39E-25	mr1039_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412231824	1.99E-09	1.19E-17	mr1632_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0412231824:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact