Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412011347:

Variant ID: vg0412011347 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12011347
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

TATCTTGTTGTTCATCCATGATGTGAGCAACGGATGTATCCGTAGTAGCCTTAGTCACATCATTCAGTATCACCAGTATATTCATCCTCTAAATTATCAT[C/T]
GACGTACTCACCATCAATGTCATCTTCATTACGCCCACCATTGCCTCTAGCATTGAGATAATCAAAATGCCTCACAAGAGCAGCAAGGCTAATGTCAATG

Reverse complement sequence

CATTGACATTAGCCTTGCTGCTCTTGTGAGGCATTTTGATTATCTCAATGCTAGAGGCAATGGTGGGCGTAATGAAGATGACATTGATGGTGAGTACGTC[G/A]
ATGATAATTTAGAGGATGAATATACTGGTGATACTGAATGATGTGACTAAGGCTACTACGGATACATCCGTTGCTCACATCATGGATGAACAACAAGATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.30%	2.90%	0.78%	0.00%	NA
All Indica	2759	94.10%	4.70%	1.20%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.13%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	96.50%	2.70%	0.84%	0.00%	NA
Indica II	465	90.50%	8.00%	1.51%	0.00%	NA
Indica III	913	99.30%	0.50%	0.11%	0.00%	NA
Indica Intermediate	786	88.20%	9.30%	2.54%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412011347	C -> T	LOC_Os04g21300.1	upstream_gene_variant ; 2485.0bp to feature; MODIFIER	silent_mutation	Average:47.961; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0412011347	C -> T	LOC_Os04g21310.1	downstream_gene_variant ; 4743.0bp to feature; MODIFIER	silent_mutation	Average:47.961; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0412011347	C -> T	LOC_Os04g21290.1	intron_variant ; MODIFIER	silent_mutation	Average:47.961; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412011347	NA	5.45E-06	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412011347	NA	8.93E-06	mr1622	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412011347	1.08E-06	1.08E-06	mr1687	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412011347	3.22E-06	3.22E-06	mr1774	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412011347	2.53E-06	2.53E-06	mr1777	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251