Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411353933:

Variant ID: vg0411353933 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 11353933
Reference Allele: GAATTAAA	Alternative Allele: AAATTAAA,G
Primary Allele: GAATTAAA	Secondary Allele: AAATTAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTATATTTGGATAAAAAGAACATAAATTGTTTATAGCAAATTTTGTTACCCACATTTGAAGAATCAAGTCAACAATTTTCTGGACACCACGAAGACCAT[GAATTAAA/AAATTAAA,G]
AAGAAGAAAGTGTCTCGACAAACATTTTCAACCCAAAGAACTATACACCATGCCAATCATGTTGAAGGCAAGGTTATCAATGTATAGCAAAAATAGAGAT

Reverse complement sequence

ATCTCTATTTTTGCTATACATTGATAACCTTGCCTTCAACATGATTGGCATGGTGTATAGTTCTTTGGGTTGAAAATGTTTGTCGAGACACTTTCTTCTT[TTTAATTC/TTTAATTT,C]
ATGGTCTTCGTGGTGTCCAGAAAATTGTTGACTTGATTCTTCAAATGTGGGTAACAAAATTTGCTATAAACAATTTATGTTCTTTTTATCCAAATATACC

Allele Frequencies:

Populations	Population Size	Frequency of GAATTAAA(primary allele)	Frequency of AAATTAAA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	4.90%	4.78%	35.23%	G: 0.17%
All Indica	2759	34.00%	8.20%	5.94%	51.61%	G: 0.25%
All Japonica	1512	99.30%	0.10%	0.13%	0.53%	NA
Aus	269	6.70%	0.00%	18.59%	74.35%	G: 0.37%
Indica I	595	29.90%	0.50%	3.53%	65.55%	G: 0.50%
Indica II	465	17.00%	25.60%	10.97%	46.45%	NA
Indica III	913	41.70%	3.80%	4.93%	49.18%	G: 0.33%
Indica Intermediate	786	38.00%	8.90%	5.98%	46.95%	G: 0.13%
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	99.00%	0.00%	0.00%	0.99%	NA
Japonica Intermediate	241	98.30%	0.00%	0.83%	0.83%	NA
VI/Aromatic	96	86.50%	0.00%	4.17%	9.38%	NA
Intermediate	90	63.30%	3.30%	6.67%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0411353933	GAATTAAA -> DEL	N	N	silent_mutation	Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0411353933	GAATTAAA -> G	LOC_Os04g20290.1	upstream_gene_variant ; 4585.0bp to feature; MODIFIER	silent_mutation	Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0411353933	GAATTAAA -> G	LOC_Os04g20300.1	upstream_gene_variant ; 2726.0bp to feature; MODIFIER	silent_mutation	Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0411353933	GAATTAAA -> G	LOC_Os04g20310.1	upstream_gene_variant ; 4859.0bp to feature; MODIFIER	silent_mutation	Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0411353933	GAATTAAA -> G	LOC_Os04g20290-LOC_Os04g20300	intergenic_region ; MODIFIER	silent_mutation	Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0411353933	GAATTAAA -> AAATTAAA	LOC_Os04g20290.1	upstream_gene_variant ; 4584.0bp to feature; MODIFIER	silent_mutation	Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0411353933	GAATTAAA -> AAATTAAA	LOC_Os04g20300.1	upstream_gene_variant ; 2727.0bp to feature; MODIFIER	silent_mutation	Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0411353933	GAATTAAA -> AAATTAAA	LOC_Os04g20310.1	upstream_gene_variant ; 4860.0bp to feature; MODIFIER	silent_mutation	Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0411353933	GAATTAAA -> AAATTAAA	LOC_Os04g20290-LOC_Os04g20300	intergenic_region ; MODIFIER	silent_mutation	Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0411353933	NA	3.36E-07	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411353933	4.73E-06	NA	mr1584_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411353933	4.84E-07	4.84E-07	mr1584_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251