Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410375848:

Variant ID: vg0410375848 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10375848
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGGGATTAGCCAAAAAAACCTCTAAAAATTAAGCACTTACAAATTAAAGGTTTTCCTTACTGTTATTATTAAGGTCGACACACATTTTTTAACAACCT[A/T]
TGGTTATATAGACCTCTAATCATTAATTCTGGTCATATTAACGGTACAGGGCTTACTAGAATGGGATTTCTATTTTAGGTCTAAGAAGAATTATGCAAGG

Reverse complement sequence

CCTTGCATAATTCTTCTTAGACCTAAAATAGAAATCCCATTCTAGTAAGCCCTGTACCGTTAATATGACCAGAATTAATGATTAGAGGTCTATATAACCA[T/A]
AGGTTGTTAAAAAATGTGTGTCGACCTTAATAATAACAGTAAGGAAAACCTTTAATTTGTAAGTGCTTAATTTTTAGAGGTTTTTTTGGCTAATCCCTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.50%	5.90%	26.81%	35.87%	NA
All Indica	2759	2.80%	9.70%	37.01%	50.45%	NA
All Japonica	1512	89.20%	0.10%	2.51%	8.13%	NA
Aus	269	0.70%	0.70%	43.12%	55.39%	NA
Indica I	595	1.20%	1.80%	17.14%	79.83%	NA
Indica II	465	3.70%	4.70%	58.06%	33.55%	NA
Indica III	913	2.80%	18.50%	38.77%	39.87%	NA
Indica Intermediate	786	3.40%	8.50%	37.53%	50.51%	NA
Temperate Japonica	767	97.50%	0.00%	0.52%	1.96%	NA
Tropical Japonica	504	78.60%	0.40%	5.56%	15.48%	NA
Japonica Intermediate	241	85.10%	0.00%	2.49%	12.45%	NA
VI/Aromatic	96	21.90%	1.00%	64.58%	12.50%	NA
Intermediate	90	42.20%	3.30%	33.33%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410375848	A -> DEL	N	N	silent_mutation	Average:9.196; most accessible tissue: Zhenshan97 flower, score: 14.863	N	N	N	N
vg0410375848	A -> T	LOC_Os04g18710.1	upstream_gene_variant ; 130.0bp to feature; MODIFIER	silent_mutation	Average:9.196; most accessible tissue: Zhenshan97 flower, score: 14.863	N	N	N	N
vg0410375848	A -> T	LOC_Os04g18710-LOC_Os04g18720	intergenic_region ; MODIFIER	silent_mutation	Average:9.196; most accessible tissue: Zhenshan97 flower, score: 14.863	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410375848	NA	4.07E-08	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410375848	NA	4.93E-07	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410375848	9.28E-07	3.45E-10	mr1841	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410375848	7.37E-08	7.36E-08	mr1900	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410375848	NA	1.34E-07	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410375848	NA	3.39E-07	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410375848	NA	1.51E-08	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410375848	NA	1.15E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251