Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410239270:

Variant ID: vg0410239270 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10239270
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCATTCTCGGTGTTAGTGCTTCCATCTTTATGATACTTTAATCTTGTTTATGTAATTCGTCGAAGTTATCATATATCTTATATAATCTCCGGCAATATCG[C/T]
TATCTAACCTTAAATCGGCTAACGTCTGTTATTAGAAGGTAGCCGATTAGGTTAAATACCAACATTGACTTAGATTACATAGGATATCAACCACTCTTTG

Reverse complement sequence

CAAAGAGTGGTTGATATCCTATGTAATCTAAGTCAATGTTGGTATTTAACCTAATCGGCTACCTTCTAATAACAGACGTTAGCCGATTTAAGGTTAGATA[G/A]
CGATATTGCCGGAGATTATATAAGATATATGATAACTTCGACGAATTACATAAACAAGATTAAAGTATCATAAAGATGGAAGCACTAACACCGAGAATGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.10%	1.50%	16.48%	40.88%	NA
All Indica	2759	10.70%	2.40%	25.84%	61.11%	NA
All Japonica	1512	99.10%	0.00%	0.13%	0.79%	NA
Aus	269	4.50%	2.60%	18.96%	73.98%	NA
Indica I	595	10.40%	0.50%	13.61%	75.46%	NA
Indica II	465	13.30%	1.90%	18.92%	65.81%	NA
Indica III	913	7.30%	3.10%	40.74%	48.85%	NA
Indica Intermediate	786	13.20%	3.20%	21.88%	61.70%	NA
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	98.60%	0.00%	0.00%	1.39%	NA
Japonica Intermediate	241	97.90%	0.00%	0.41%	1.66%	NA
VI/Aromatic	96	87.50%	0.00%	2.08%	10.42%	NA
Intermediate	90	60.00%	0.00%	12.22%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410239270	C -> DEL	N	N	silent_mutation	Average:8.603; most accessible tissue: Callus, score: 28.168	N	N	N	N
vg0410239270	C -> T	LOC_Os04g18520.1	upstream_gene_variant ; 3494.0bp to feature; MODIFIER	silent_mutation	Average:8.603; most accessible tissue: Callus, score: 28.168	N	N	N	N
vg0410239270	C -> T	LOC_Os04g18530.1	downstream_gene_variant ; 934.0bp to feature; MODIFIER	silent_mutation	Average:8.603; most accessible tissue: Callus, score: 28.168	N	N	N	N
vg0410239270	C -> T	LOC_Os04g18540.1	downstream_gene_variant ; 4536.0bp to feature; MODIFIER	silent_mutation	Average:8.603; most accessible tissue: Callus, score: 28.168	N	N	N	N
vg0410239270	C -> T	LOC_Os04g18520-LOC_Os04g18530	intergenic_region ; MODIFIER	silent_mutation	Average:8.603; most accessible tissue: Callus, score: 28.168	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410239270	2.78E-06	9.31E-07	mr1426	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251