Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410126275:

Variant ID: vg0410126275 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10126275
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAACACAAGAAACTCTAACTATCTAAATAAAGGTGTGAGGATGACCAAGTGGACCCTAGGGTCGTGCTCCTCCTGGTTGAGGCGCACCCCATATGGGCC[C/G]
CACTTGGGCGGGGGTCCCAAACGAAGTTACAAGCCCAAAGGCCCATGACAGGTGACGCAACACCTTGTTTTTGTGTTTGCGGCCAAACGAGATGGAGTCT

Reverse complement sequence

AGACTCCATCTCGTTTGGCCGCAAACACAAAAACAAGGTGTTGCGTCACCTGTCATGGGCCTTTGGGCTTGTAACTTCGTTTGGGACCCCCGCCCAAGTG[G/C]
GGCCCATATGGGGTGCGCCTCAACCAGGAGGAGCACGACCCTAGGGTCCACTTGGTCATCCTCACACCTTTATTTAGATAGTTAGAGTTTCTTGTGTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.00%	0.10%	10.88%	5.01%	NA
All Indica	2759	78.80%	0.10%	16.85%	4.20%	NA
All Japonica	1512	99.70%	0.00%	0.26%	0.07%	NA
Aus	269	45.70%	0.70%	13.01%	40.52%	NA
Indica I	595	77.60%	0.20%	19.83%	2.35%	NA
Indica II	465	72.00%	0.20%	25.81%	1.94%	NA
Indica III	913	83.80%	0.10%	9.86%	6.24%	NA
Indica Intermediate	786	78.00%	0.00%	17.43%	4.58%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.00%	0.60%	0.20%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	89.60%	0.00%	2.08%	8.33%	NA
Intermediate	90	87.80%	0.00%	8.89%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410126275	C -> DEL	LOC_Os04g18340.1	N	frameshift_variant	Average:19.472; most accessible tissue: Callus, score: 42.891	N	N	N	N
vg0410126275	C -> G	LOC_Os04g18340.1	missense_variant ; p.Gly355Ala; MODERATE	nonsynonymous_codon ; G355A	Average:19.472; most accessible tissue: Callus, score: 42.891	possibly damaging	1.557	TOLERATED	0.10

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410126275	NA	3.12E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275	NA	3.31E-13	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275	3.99E-07	6.97E-15	mr1034	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275	NA	3.92E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275	NA	4.78E-06	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275	NA	6.97E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275	NA	4.55E-06	mr1610	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275	NA	4.14E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251