| Variant ID: vg0409654224 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 9654224 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )
TGTGATTAGGGACATCCTAGGGTTGCCCTAGGGCACACACCCCCTTGGGCTAAGCCCACGACACAATTACAAGGCCCAAAACCCAAATTAGATTCGGACT[G/A,C]
GATGAGGTACGTGGCTTGTTTTGCAGATTCCCGGCAGCTCGGTAGGAATTTTGACATGGGACCAAAACCATCTGAAAGTAGACTCCATAAGCTTTCCATC
GATGGAAAGCTTATGGAGTCTACTTTCAGATGGTTTTGGTCCCATGTCAAAATTCCTACCGAGCTGCCGGGAATCTGCAAAACAAGCCACGTACCTCATC[C/T,G]
AGTCCGAATCTAATTTGGGTTTTGGGCCTTGTAATTGTGTCGTGGGCTTAGCCCAAGGGGGTGTGTGCCCTAGGGCAACCCTAGGATGTCCCTAATCACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 65.70% | 34.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.90% | 86.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0409654224 | G -> C | LOC_Os04g17640.1 | upstream_gene_variant ; 2313.0bp to feature; MODIFIER | N | Average:35.885; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0409654224 | G -> C | LOC_Os04g17630.1 | downstream_gene_variant ; 3568.0bp to feature; MODIFIER | N | Average:35.885; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0409654224 | G -> C | LOC_Os04g17630-LOC_Os04g17640 | intergenic_region ; MODIFIER | N | Average:35.885; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0409654224 | G -> A | LOC_Os04g17640.1 | upstream_gene_variant ; 2313.0bp to feature; MODIFIER | silent_mutation | Average:35.885; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0409654224 | G -> A | LOC_Os04g17630.1 | downstream_gene_variant ; 3568.0bp to feature; MODIFIER | silent_mutation | Average:35.885; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0409654224 | G -> A | LOC_Os04g17630-LOC_Os04g17640 | intergenic_region ; MODIFIER | silent_mutation | Average:35.885; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0409654224 | 3.55E-06 | 3.55E-06 | mr1144 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409654224 | NA | 8.97E-07 | mr1157 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409654224 | NA | 6.11E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409654224 | NA | 1.03E-06 | mr1446 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409654224 | NA | 6.96E-13 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409654224 | NA | 8.14E-12 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409654224 | NA | 2.31E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409654224 | NA | 7.25E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409654224 | NA | 4.69E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409654224 | NA | 8.40E-06 | mr1786 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409654224 | NA | 1.40E-11 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |