Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409570147:

Variant ID: vg0409570147 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9570147
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


GCACATAGGAAAGAAACATAATTAACTACAGCATTCAACCTACCATAATTAGCCCATTGCATGCGGAAATATTTATTGCATGCATATAACTCATTCCATA[T/C]
CTTGCATATAAACGGGTGTACCCGTTAACTTCCAAGCCAATCAAATTGATCTGGATTACATCCAACGGTCAGAAAGTTTGGAGCCCATGCACCATGGTGC

Reverse complement sequence

GCACCATGGTGCATGGGCTCCAAACTTTCTGACCGTTGGATGTAATCCAGATCAATTTGATTGGCTTGGAAGTTAACGGGTACACCCGTTTATATGCAAG[A/G]
TATGGAATGAGTTATATGCATGCAATAAATATTTCCGCATGCAATGGGCTAATTATGGTAGGTTGAATGCTGTAGTTAATTATGTTTCTTTCCTATGTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 2.50% 2.96% 39.27% NA
All Indica  2759 33.10% 4.30% 4.57% 58.06% NA
All Japonica  1512 98.40% 0.00% 0.00% 1.59% NA
Aus  269 23.00% 0.00% 1.86% 75.09% NA
Indica I  595 13.90% 14.30% 3.36% 68.40% NA
Indica II  465 39.80% 1.50% 4.30% 54.41% NA
Indica III  913 39.80% 0.70% 5.37% 54.22% NA
Indica Intermediate  786 35.90% 2.50% 4.71% 56.87% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 95.80% 0.00% 0.00% 4.17% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 86.50% 0.00% 0.00% 13.54% NA
Intermediate  90 72.20% 1.10% 10.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409570147 T -> C LOC_Os04g17490.1 upstream_gene_variant ; 1699.0bp to feature; MODIFIER silent_mutation Average:64.973; most accessible tissue: Zhenshan97 flower, score: 85.228 N N N N
vg0409570147 T -> C LOC_Os04g17500.1 downstream_gene_variant ; 1142.0bp to feature; MODIFIER silent_mutation Average:64.973; most accessible tissue: Zhenshan97 flower, score: 85.228 N N N N
vg0409570147 T -> C LOC_Os04g17490-LOC_Os04g17500 intergenic_region ; MODIFIER silent_mutation Average:64.973; most accessible tissue: Zhenshan97 flower, score: 85.228 N N N N
vg0409570147 T -> DEL N N silent_mutation Average:64.973; most accessible tissue: Zhenshan97 flower, score: 85.228 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0409570147 T C 0.02 0.02 0.02 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409570147 9.67E-06 5.16E-09 mr1212_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 9.87E-06 9.87E-06 mr1488_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 NA 2.08E-06 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 NA 5.38E-06 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 8.36E-06 8.36E-06 mr1753_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 NA 1.10E-06 mr1759_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 NA 3.94E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 9.55E-06 9.55E-06 mr1764_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 NA 3.79E-06 mr1779_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 NA 4.66E-06 mr1811_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 NA 4.66E-06 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 NA 1.34E-08 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 NA 4.12E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409570147 NA 1.46E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251