Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409436808:

Variant ID: vg0409436808 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9436808
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.38, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCATACATCAAGGGAGGAACATTCAGGTTTCCTATGAATTTTATCACTCGATGAGCTCTGCCAGACCACTTGGGATGGGTCAACTACCAATCGGCTTG[C/T]
TCTTTGCTGATAAAATTCAATGCCGAGGAGAAATCTCATCAACCTTGATGATGGATCGGCTGCTGAATATCCAAGGACCTCCTTTGGGCAGCATTGAAAA

Reverse complement sequence

TTTTCAATGCTGCCCAAAGGAGGTCCTTGGATATTCAGCAGCCGATCCATCATCAAGGTTGATGAGATTTCTCCTCGGCATTGAATTTTATCAGCAAAGA[G/A]
CAAGCCGATTGGTAGTTGACCCATCCCAAGTGGTCTGGCAGAGCTCATCGAGTGATAAAATTCATAGGAAACCTGAATGTTCCTCCCTTGATGTATGCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 20.20% 0.93% 13.14% NA
All Indica  2759 99.10% 0.50% 0.07% 0.40% NA
All Japonica  1512 2.20% 60.90% 2.78% 34.13% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.60% 1.10% 0.22% 1.08% NA
Indica III  913 99.60% 0.20% 0.00% 0.22% NA
Indica Intermediate  786 98.90% 0.50% 0.13% 0.51% NA
Temperate Japonica  767 0.50% 95.80% 0.00% 3.65% NA
Tropical Japonica  504 3.60% 4.40% 7.54% 84.52% NA
Japonica Intermediate  241 4.60% 68.00% 1.66% 25.73% NA
VI/Aromatic  96 21.90% 0.00% 0.00% 78.12% NA
Intermediate  90 58.90% 20.00% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409436808 C -> DEL LOC_Os04g17210.1 N frameshift_variant Average:68.383; most accessible tissue: Minghui63 flag leaf, score: 88.574 N N N N
vg0409436808 C -> T LOC_Os04g17210.1 missense_variant ; p.Leu290Phe; MODERATE nonsynonymous_codon ; L290F Average:68.383; most accessible tissue: Minghui63 flag leaf, score: 88.574 benign -0.355 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409436808 NA 1.27E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 1.23E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 8.15E-11 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 3.45E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 1.03E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 4.62E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 8.86E-06 NA mr1550 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 1.91E-20 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 5.50E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 4.48E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 8.63E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 3.27E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 2.12E-29 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 3.20E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409436808 NA 2.39E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251