RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0408888649:

Variant ID: vg0408888649 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8888649
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATACCGGCGCATCCTCTCAAAAGCTAACCTCAAATCGGCCATGTGTCCTTCTATACCATCCGATTTGACAACAATATCGTCAATATAGATCTCTAAGATA[A/G,T]
TACCTAGCAAATCATGAAAGATCAAATTCATCTCCCTTTGTATATGTTGCACCGGCGTTCTTCAACCCAAAAGTCATGACAACCCACTCAAACAAACCTA

Reverse complement sequence

TAGGTTTGTTTGAGTGGGTTGTCATGACTTTTGGGTTGAAGAACGCCGGTGCAACATATACAAAGGGAGATGAATTTGATCTTTCATGATTTGCTAGGTA[T/C,A]
TATCTTAGAGATCTATATTGACGATATTGTTGTCAAATCGGATGGTATAGAAGGACACATGGCCGATTTGAGGTTAGCTTTTGAGAGGATGCGCCGGTAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.90%	2.10%	1.16%	12.74%	T: 0.06%
All Indica	2759	95.80%	3.50%	0.36%	0.29%	NA
All Japonica	1512	63.60%	0.10%	1.65%	34.66%	T: 0.07%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.60%	1.30%	1.01%	0.00%	NA
Indica II	465	87.30%	11.60%	0.22%	0.86%	NA
Indica III	913	99.70%	0.10%	0.00%	0.22%	NA
Indica Intermediate	786	95.00%	4.30%	0.38%	0.25%	NA
Temperate Japonica	767	96.20%	0.10%	0.00%	3.65%	NA
Tropical Japonica	504	9.30%	0.00%	4.37%	86.11%	T: 0.20%
Japonica Intermediate	241	73.00%	0.00%	1.24%	25.73%	NA
VI/Aromatic	96	24.00%	0.00%	18.75%	57.29%	NA
Intermediate	90	77.80%	1.10%	2.22%	16.67%	T: 2.22%

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408888649	A -> DEL	LOC_Os04g16350.1	N	frameshift_variant	Average:22.348; most accessible tissue: Zhenshan97 flag leaf, score: 29.417	N	N	N	N
vg0408888649	A -> G	LOC_Os04g16350.1	missense_variant ; p.Ile74Thr; MODERATE	nonsynonymous_codon ; I74T	Average:22.348; most accessible tissue: Zhenshan97 flag leaf, score: 29.417	benign	0.536	TOLERATED	0.08
vg0408888649	A -> T	LOC_Os04g16350.1	missense_variant ; p.Ile74Asn; MODERATE	nonsynonymous_codon ; I74N	Average:22.348; most accessible tissue: Zhenshan97 flag leaf, score: 29.417	benign	1.238	TOLERATED	0.05

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408888649	7.42E-08	9.68E-12	mr1310	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408888649	NA	9.10E-15	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408888649	NA	4.98E-10	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408888649	NA	4.26E-09	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408888649	NA	3.34E-09	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408888649	NA	6.35E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408888649	NA	1.53E-09	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408888649	NA	1.90E-11	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408888649	NA	1.79E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 9 of 9 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0408888649:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact