Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408653397:

Variant ID: vg0408653397 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8653397
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

CAACGGGACATTGATGTGGATCTTCTGGATTACTTCAACAAAACGAGCGAATTGCTCGTCCACTGACGGTTTCCTCATCCGTTAAGGAAACAGCAGCAAT[T/C]
GTGTGTCGTAGTACTCCTGCTGTACGGTCTTTTCTGGCTGATCTTCCTTGTCAGTTGAGTCACTAGATGGCGCTTCTTTTGCAATCTCGTTTGTTCCTGC

Reverse complement sequence

GCAGGAACAAACGAGATTGCAAAAGAAGCGCCATCTAGTGACTCAACTGACAAGGAAGATCAGCCAGAAAAGACCGTACAGCAGGAGTACTACGACACAC[A/G]
ATTGCTGCTGTTTCCTTAACGGATGAGGAAACCGTCAGTGGACGAGCAATTCGCTCGTTTTGTTGAAGTAATCCAGAAGATCCACATCAATGTCCCGTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.50%	9.00%	2.56%	0.00%	NA
All Indica	2759	85.50%	10.80%	3.73%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	53.50%	41.60%	4.83%	0.00%	NA
Indica I	595	95.50%	1.00%	3.53%	0.00%	NA
Indica II	465	63.00%	32.70%	4.30%	0.00%	NA
Indica III	913	94.20%	5.30%	0.55%	0.00%	NA
Indica Intermediate	786	81.20%	11.60%	7.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	82.20%	12.20%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408653397	T -> C	LOC_Os04g15944.1	downstream_gene_variant ; 3886.0bp to feature; MODIFIER	silent_mutation	Average:46.572; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N
vg0408653397	T -> C	LOC_Os04g15930.1	intron_variant ; MODIFIER	silent_mutation	Average:46.572; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408653397	NA	1.21E-09	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	2.20E-08	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	5.28E-12	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	5.73E-11	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	1.76E-10	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	5.27E-11	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	2.21E-11	mr1726	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	1.34E-07	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	2.02E-11	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	5.16E-12	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	6.98E-08	9.63E-17	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	2.84E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	2.28E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	2.87E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	6.85E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	3.08E-08	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	7.41E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	4.57E-08	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	2.01E-13	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408653397	NA	1.58E-08	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251