Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408484082:

Variant ID: vg0408484082 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8484082
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGTTGGACTATTATCGTAACAACTTTCTCATTTTCTGTTAGTATATTTCGTAAACTGCTACTTCCTCCGTTTCACAATGTAAGTCATTTTAGCATTTT[C/T]
CATATTCATATTGATGTTAATAATGAATCGAAACATATATATCTATCTAGATTCATTAGCATCTATATGAATGTGGGAAATGCTAGAATGACTTACATTG

Reverse complement sequence

CAATGTAAGTCATTCTAGCATTTCCCACATTCATATAGATGCTAATGAATCTAGATAGATATATATGTTTCGATTCATTATTAACATCAATATGAATATG[G/A]
AAAATGCTAAAATGACTTACATTGTGAAACGGAGGAAGTAGCAGTTTACGAAATATACTAACAGAAAATGAGAAAGTTGTTACGATAATAGTCCAACCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.50%	30.70%	1.76%	27.99%	NA
All Indica	2759	9.10%	46.90%	2.17%	41.79%	NA
All Japonica	1512	88.20%	9.60%	0.93%	1.32%	NA
Aus	269	52.80%	0.00%	2.23%	44.98%	NA
Indica I	595	0.30%	76.80%	1.18%	21.68%	NA
Indica II	465	24.30%	25.60%	2.80%	47.31%	NA
Indica III	913	7.40%	40.90%	1.75%	49.95%	NA
Indica Intermediate	786	8.80%	43.90%	3.05%	44.27%	NA
Temperate Japonica	767	92.80%	5.90%	0.91%	0.39%	NA
Tropical Japonica	504	96.40%	1.00%	0.00%	2.58%	NA
Japonica Intermediate	241	56.00%	39.40%	2.90%	1.66%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	52.20%	15.60%	3.33%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408484082	C -> DEL	N	N	silent_mutation	Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N
vg0408484082	C -> T	LOC_Os04g15590.1	upstream_gene_variant ; 1451.0bp to feature; MODIFIER	silent_mutation	Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N
vg0408484082	C -> T	LOC_Os04g15600.1	upstream_gene_variant ; 631.0bp to feature; MODIFIER	silent_mutation	Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N
vg0408484082	C -> T	LOC_Os04g15610.1	upstream_gene_variant ; 2297.0bp to feature; MODIFIER	silent_mutation	Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N
vg0408484082	C -> T	LOC_Os04g15590-LOC_Os04g15600	intergenic_region ; MODIFIER	silent_mutation	Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408484082	NA	7.61E-16	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082	7.07E-06	NA	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082	6.36E-07	NA	mr1118_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082	NA	3.57E-08	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082	NA	1.39E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082	NA	5.20E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082	NA	1.37E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251