Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408431062:

Variant ID: vg0408431062 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8431062
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATCTGAGTTGTGGCAGATACATTACAACATTTGATCAAGGTAACAGTTGATGAGTTAATTAGTCAGAAAACCCAGCTCGGGGGGCAGATTGAAGAACAA[T/C]
AACAGCATCAGCTTGGGGGGCAGGCACATCAATGTCAGCATGATGAGCTATATCAACAGTATCAGCCAGAAGAATCTCAAAGATATTAGAATATAGAAGA

Reverse complement sequence

TCTTCTATATTCTAATATCTTTGAGATTCTTCTGGCTGATACTGTTGATATAGCTCATCATGCTGACATTGATGTGCCTGCCCCCCAAGCTGATGCTGTT[A/G]
TTGTTCTTCAATCTGCCCCCCGAGCTGGGTTTTCTGACTAATTAACTCATCAACTGTTACCTTGATCAAATGTTGTAATGTATCTGCCACAACTCAGATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.30%	11.60%	5.06%	58.02%	NA
All Indica	2759	3.70%	0.60%	8.34%	87.39%	NA
All Japonica	1512	65.00%	33.60%	0.13%	1.26%	NA
Aus	269	0.70%	0.00%	1.12%	98.14%	NA
Indica I	595	3.90%	0.00%	5.55%	90.59%	NA
Indica II	465	4.70%	1.30%	23.44%	70.54%	NA
Indica III	913	1.00%	0.30%	4.16%	94.52%	NA
Indica Intermediate	786	6.10%	0.90%	6.36%	86.64%	NA
Temperate Japonica	767	96.60%	2.90%	0.00%	0.52%	NA
Tropical Japonica	504	13.30%	84.30%	0.00%	2.38%	NA
Japonica Intermediate	241	72.60%	25.30%	0.83%	1.24%	NA
VI/Aromatic	96	79.20%	6.20%	0.00%	14.58%	NA
Intermediate	90	36.70%	21.10%	4.44%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408431062	T -> C	LOC_Os04g15000.1	upstream_gene_variant ; 3659.0bp to feature; MODIFIER	silent_mutation	Average:13.638; most accessible tissue: Callus, score: 36.045	N	N	N	N
vg0408431062	T -> C	LOC_Os04g15510.1	upstream_gene_variant ; 2226.0bp to feature; MODIFIER	silent_mutation	Average:13.638; most accessible tissue: Callus, score: 36.045	N	N	N	N
vg0408431062	T -> C	LOC_Os04g15000-LOC_Os04g15510	intergenic_region ; MODIFIER	silent_mutation	Average:13.638; most accessible tissue: Callus, score: 36.045	N	N	N	N
vg0408431062	T -> DEL	N	N	silent_mutation	Average:13.638; most accessible tissue: Callus, score: 36.045	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408431062	NA	1.56E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	6.86E-06	mr1220	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	3.90E-15	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	3.58E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	2.83E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	1.26E-10	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	2.58E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	4.21E-06	NA	mr1726	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	5.71E-08	mr1739	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	5.44E-10	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	1.95E-06	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	2.86E-09	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	5.69E-19	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	1.72E-14	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	1.07E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062	NA	5.70E-14	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251